Incidental Mutation 'R8132:Cops7b'
ID632048
Institutional Source Beutler Lab
Gene Symbol Cops7b
Ensembl Gene ENSMUSG00000026240
Gene NameCOP9 signalosome subunit 7B
SynonymsCOP9 complex S7b, D1Wsu66e
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.209) question?
Stock #R8132 (G1)
Quality Score181.009
Status Not validated
Chromosome1
Chromosomal Location86582904-86609375 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 86587194 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 102 (G102V)
Ref Sequence ENSEMBL: ENSMUSP00000122317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027444] [ENSMUST00000027446] [ENSMUST00000121534] [ENSMUST00000122884] [ENSMUST00000138280] [ENSMUST00000143674] [ENSMUST00000146220] [ENSMUST00000149542]
Predicted Effect probably benign
Transcript: ENSMUST00000027444
SMART Domains Protein: ENSMUSP00000027444
Gene: ENSMUSG00000026239

DomainStartEndE-ValueType
Pfam:GMP_PDE_delta 9 149 1e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000027446
SMART Domains Protein: ENSMUSP00000027446
Gene: ENSMUSG00000026240

DomainStartEndE-ValueType
PINT 87 177 2.07e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121534
SMART Domains Protein: ENSMUSP00000113587
Gene: ENSMUSG00000026240

DomainStartEndE-ValueType
PINT 87 177 2.07e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122884
SMART Domains Protein: ENSMUSP00000119807
Gene: ENSMUSG00000026240

DomainStartEndE-ValueType
PDB:3CHM|A 4 78 4e-9 PDB
Blast:PINT 30 54 7e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000138280
SMART Domains Protein: ENSMUSP00000115056
Gene: ENSMUSG00000026240

DomainStartEndE-ValueType
Blast:PINT 30 54 9e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000143674
SMART Domains Protein: ENSMUSP00000137956
Gene: ENSMUSG00000026239

DomainStartEndE-ValueType
Pfam:GMP_PDE_delta 7 64 4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146220
SMART Domains Protein: ENSMUSP00000137820
Gene: ENSMUSG00000026239

DomainStartEndE-ValueType
Pfam:GMP_PDE_delta 7 124 6.9e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000149542
AA Change: G102V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000122317
Gene: ENSMUSG00000026240
AA Change: G102V

DomainStartEndE-ValueType
low complexity region 137 148 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,965,018 A403T Het
Abhd16b G A 2: 181,493,967 A221T probably damaging Het
Arhgef1 C T 7: 24,919,749 Q472* probably null Het
Arhgef1 C T 7: 24,907,662 probably benign Het
Calr3 C T 8: 72,427,179 G298S probably damaging Het
Chrng A G 1: 87,205,996 T15A unknown Het
CK137956 T A 4: 127,951,282 K223* probably null Het
Clca3b A T 3: 144,847,174 S97T probably benign Het
Dennd1a T A 2: 37,858,060 S382C probably damaging Het
Fdps G A 3: 89,099,386 Q66* probably null Het
Gemin4 T C 11: 76,212,913 T341A probably benign Het
Gm37596 G A 3: 93,692,145 Q306* probably null Het
Grk3 A G 5: 112,961,489 S201P unknown Het
Hgf C T 5: 16,602,331 T407I probably damaging Het
Hip1r C T 5: 123,997,227 R446C probably damaging Het
Hyal6 A T 6: 24,740,828 I327L possibly damaging Het
Ifna15 T C 4: 88,557,683 E188G possibly damaging Het
Igip A G 18: 36,301,213 S11G probably benign Het
Igkv5-39 A G 6: 69,900,605 Y56H probably damaging Het
Jph1 G A 1: 17,016,155 T381I probably damaging Het
Lrrc55 T C 2: 85,191,915 I311V probably benign Het
Mrps35 T A 6: 147,048,163 D58E probably benign Het
Ms4a4d C A 19: 11,557,946 P203T probably benign Het
Naip1 T G 13: 100,437,375 E225D possibly damaging Het
Ncapg2 T A 12: 116,444,347 I989N possibly damaging Het
Nek3 A T 8: 22,157,020 Y166* probably null Het
Nphs1 A G 7: 30,482,053 E1169G probably benign Het
Nudt15 G A 14: 73,521,659 P123L probably benign Het
Olfr1491 G A 19: 13,705,220 C131Y probably damaging Het
Olfr160 C T 9: 37,712,073 V69M probably benign Het
Olfr204 T C 16: 59,314,544 I288V possibly damaging Het
Olfr427 T A 1: 174,100,171 S238T probably damaging Het
Olfr95 T A 17: 37,211,316 E179V probably damaging Het
Pcdha5 T C 18: 36,960,641 S68P possibly damaging Het
Plec G T 15: 76,190,573 A330E unknown Het
Rpa3 A C 6: 8,256,790 I63S probably damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Snap25 A T 2: 136,769,828 K83N probably benign Het
Sos1 T G 17: 80,408,602 Q977P probably damaging Het
Spag16 A G 1: 70,381,302 Y483C probably damaging Het
Speg A G 1: 75,422,995 E2362G probably damaging Het
Swap70 A G 7: 110,255,877 D128G probably damaging Het
Syngap1 G A 17: 26,958,180 M545I probably damaging Het
Tmem147 T C 7: 30,728,447 E110G probably damaging Het
Tmem156 T A 5: 65,075,755 I155F probably benign Het
Trim25 C A 11: 89,016,606 A597E probably damaging Het
Ttc7b T C 12: 100,446,872 Y229C probably damaging Het
Utrn T A 10: 12,682,410 Q1435L probably damaging Het
Zbtb41 T C 1: 139,423,217 S23P probably benign Het
Zeb2 T A 2: 44,989,130 I1075F probably damaging Het
Other mutations in Cops7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01994:Cops7b APN 1 86601106 missense probably damaging 1.00
IGL02505:Cops7b APN 1 86592321 missense probably benign 0.01
IGL03134:Cops7b UTSW 1 86592334 missense probably damaging 1.00
R0423:Cops7b UTSW 1 86599031 missense probably benign 0.07
R0479:Cops7b UTSW 1 86605076 missense probably benign 0.00
R1442:Cops7b UTSW 1 86605113 missense probably benign 0.00
R5004:Cops7b UTSW 1 86587410 unclassified probably benign
R5346:Cops7b UTSW 1 86583068 unclassified probably benign
R7406:Cops7b UTSW 1 86601130 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCTCAGCCTCAATCTAGGTGG -3'
(R):5'- ACTAGAGTGGACGTCAGGAC -3'

Sequencing Primer
(F):5'- CCTCAATCTAGGTGGGAGGTG -3'
(R):5'- GTCTTGCTCGTAGCCACCAG -3'
Posted On2020-06-30