Incidental Mutation 'R8132:Chrng'
ID632049
Institutional Source Beutler Lab
Gene Symbol Chrng
Ensembl Gene ENSMUSG00000026253
Gene Namecholinergic receptor, nicotinic, gamma polypeptide
SynonymsAcrg, Achr-3
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8132 (G1)
Quality Score221.009
Status Not validated
Chromosome1
Chromosomal Location87204657-87212694 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87205996 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 15 (T15A)
Ref Sequence ENSEMBL: ENSMUSP00000141001 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027470] [ENSMUST00000185763] [ENSMUST00000186038] [ENSMUST00000188796]
Predicted Effect probably benign
Transcript: ENSMUST00000027470
SMART Domains Protein: ENSMUSP00000027470
Gene: ENSMUSG00000026253

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 26 241 7.9e-72 PFAM
Pfam:Neur_chan_memb 248 494 9.6e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185763
SMART Domains Protein: ENSMUSP00000139600
Gene: ENSMUSG00000026253

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 20 72 1.4e-6 PFAM
Pfam:Neur_chan_LBD 117 255 1e-47 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000186038
AA Change: T15A
SMART Domains Protein: ENSMUSP00000141001
Gene: ENSMUSG00000026253
AA Change: T15A

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
Pfam:Neur_chan_LBD 48 220 1e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188796
SMART Domains Protein: ENSMUSP00000140796
Gene: ENSMUSG00000026253

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 26 142 1.3e-34 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The mammalian muscle-type acetylcholine receptor is a transmembrane pentameric glycoprotein with two alpha subunits, one beta, one delta, and one epsilon (in adult skeletal muscle) or gamma (in fetal and denervated muscle) subunit. This gene, which encodes the gamma subunit, is expressed prior to the thirty-third week of gestation in humans. The gamma subunit of the acetylcholine receptor plays a role in neuromuscular organogenesis and ligand binding and disruption of gamma subunit expression prevents the correct localization of the receptor in cell membranes. Mutations in this gene cause Escobar syndrome and a lethal form of multiple pterygium syndrome. Muscle-type acetylcholine receptor is the major antigen in the autoimmune disease myasthenia gravis.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null mice display perinatal and postnatal lethality, paradoxical breathing, abnormal skeletal muscle morphology, abnormal neuromuscular junction morphology and physiology, and are unable to suckle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,965,018 A403T Het
Abhd16b G A 2: 181,493,967 A221T probably damaging Het
Arhgef1 C T 7: 24,907,662 probably benign Het
Arhgef1 C T 7: 24,919,749 Q472* probably null Het
Calr3 C T 8: 72,427,179 G298S probably damaging Het
CK137956 T A 4: 127,951,282 K223* probably null Het
Clca3b A T 3: 144,847,174 S97T probably benign Het
Cops7b G T 1: 86,587,194 G102V probably damaging Het
Dennd1a T A 2: 37,858,060 S382C probably damaging Het
Fdps G A 3: 89,099,386 Q66* probably null Het
Gemin4 T C 11: 76,212,913 T341A probably benign Het
Gm37596 G A 3: 93,692,145 Q306* probably null Het
Grk3 A G 5: 112,961,489 S201P unknown Het
Hgf C T 5: 16,602,331 T407I probably damaging Het
Hip1r C T 5: 123,997,227 R446C probably damaging Het
Hyal6 A T 6: 24,740,828 I327L possibly damaging Het
Ifna15 T C 4: 88,557,683 E188G possibly damaging Het
Igip A G 18: 36,301,213 S11G probably benign Het
Igkv5-39 A G 6: 69,900,605 Y56H probably damaging Het
Jph1 G A 1: 17,016,155 T381I probably damaging Het
Lrrc55 T C 2: 85,191,915 I311V probably benign Het
Mrps35 T A 6: 147,048,163 D58E probably benign Het
Ms4a4d C A 19: 11,557,946 P203T probably benign Het
Naip1 T G 13: 100,437,375 E225D possibly damaging Het
Ncapg2 T A 12: 116,444,347 I989N possibly damaging Het
Nek3 A T 8: 22,157,020 Y166* probably null Het
Nphs1 A G 7: 30,482,053 E1169G probably benign Het
Nudt15 G A 14: 73,521,659 P123L probably benign Het
Olfr1491 G A 19: 13,705,220 C131Y probably damaging Het
Olfr160 C T 9: 37,712,073 V69M probably benign Het
Olfr204 T C 16: 59,314,544 I288V possibly damaging Het
Olfr427 T A 1: 174,100,171 S238T probably damaging Het
Olfr95 T A 17: 37,211,316 E179V probably damaging Het
Pcdha5 T C 18: 36,960,641 S68P possibly damaging Het
Plec G T 15: 76,190,573 A330E unknown Het
Rpa3 A C 6: 8,256,790 I63S probably damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Snap25 A T 2: 136,769,828 K83N probably benign Het
Sos1 T G 17: 80,408,602 Q977P probably damaging Het
Spag16 A G 1: 70,381,302 Y483C probably damaging Het
Speg A G 1: 75,422,995 E2362G probably damaging Het
Swap70 A G 7: 110,255,877 D128G probably damaging Het
Syngap1 G A 17: 26,958,180 M545I probably damaging Het
Tmem147 T C 7: 30,728,447 E110G probably damaging Het
Tmem156 T A 5: 65,075,755 I155F probably benign Het
Trim25 C A 11: 89,016,606 A597E probably damaging Het
Ttc7b T C 12: 100,446,872 Y229C probably damaging Het
Utrn T A 10: 12,682,410 Q1435L probably damaging Het
Zbtb41 T C 1: 139,423,217 S23P probably benign Het
Zeb2 T A 2: 44,989,130 I1075F probably damaging Het
Other mutations in Chrng
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Chrng APN 1 87206747 missense probably damaging 0.99
IGL02947:Chrng APN 1 87209884 splice site probably null
IGL03014:Chrng UTSW 1 87211037 critical splice donor site probably null
R1051:Chrng UTSW 1 87209063 missense possibly damaging 0.70
R1346:Chrng UTSW 1 87208263 missense probably benign 0.09
R1368:Chrng UTSW 1 87205853 missense probably damaging 1.00
R1588:Chrng UTSW 1 87207507 missense probably damaging 1.00
R1703:Chrng UTSW 1 87210906 missense possibly damaging 0.63
R2852:Chrng UTSW 1 87206706 missense probably benign 0.01
R3707:Chrng UTSW 1 87210611 nonsense probably null
R4780:Chrng UTSW 1 87207524 missense probably damaging 1.00
R5818:Chrng UTSW 1 87209801 missense probably benign 0.45
R5871:Chrng UTSW 1 87206729 missense possibly damaging 0.95
R6058:Chrng UTSW 1 87211352 missense probably damaging 1.00
R6136:Chrng UTSW 1 87209801 missense probably benign 0.45
R7086:Chrng UTSW 1 87211013 missense probably benign 0.06
R7229:Chrng UTSW 1 87209444 missense probably benign 0.27
R7261:Chrng UTSW 1 87207240 splice site probably null
R7572:Chrng UTSW 1 87209114 missense probably damaging 1.00
R7666:Chrng UTSW 1 87209453 missense probably benign 0.05
T0975:Chrng UTSW 1 87210626 missense probably benign 0.00
X0063:Chrng UTSW 1 87206706 missense probably benign 0.01
Z1177:Chrng UTSW 1 87205995 missense unknown
Z1177:Chrng UTSW 1 87206298 missense probably benign 0.10
Z1177:Chrng UTSW 1 87208263 missense probably benign 0.09
Z1177:Chrng UTSW 1 87208303 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGTAGAGCTACTGTCCTGC -3'
(R):5'- GACATTGACCACATCTGAGTCG -3'

Sequencing Primer
(F):5'- TCTTCACTGGGCAGAACTGAG -3'
(R):5'- ACCACATCTGAGTCGCGCTC -3'
Posted On2020-06-30