Incidental Mutation 'R8132:Zeb2'
ID632053
Institutional Source Beutler Lab
Gene Symbol Zeb2
Ensembl Gene ENSMUSG00000026872
Gene Namezinc finger E-box binding homeobox 2
SynonymsZfhx1b, Zfx1b, SIP1, 9130203F04Rik, D130016B08Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8132 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location44983632-45117395 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 44989130 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1075 (I1075F)
Ref Sequence ENSEMBL: ENSMUSP00000028229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028229] [ENSMUST00000068415] [ENSMUST00000076836] [ENSMUST00000176438] [ENSMUST00000176732] [ENSMUST00000177302] [ENSMUST00000200844]
Predicted Effect probably damaging
Transcript: ENSMUST00000028229
AA Change: I1075F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028229
Gene: ENSMUSG00000026872
AA Change: I1075F

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
ZnF_C2H2 211 234 2.09e-3 SMART
ZnF_C2H2 241 263 9.88e-5 SMART
ZnF_C2H2 282 304 4.87e-4 SMART
ZnF_C2H2 310 330 1.86e1 SMART
low complexity region 352 364 N/A INTRINSIC
ZnF_C2H2 581 601 5.54e1 SMART
HOX 644 706 2.05e-3 SMART
low complexity region 778 808 N/A INTRINSIC
low complexity region 841 856 N/A INTRINSIC
low complexity region 870 881 N/A INTRINSIC
ZnF_C2H2 999 1021 4.47e-3 SMART
ZnF_C2H2 1027 1049 2.17e-1 SMART
ZnF_C2H2 1055 1076 1.89e-1 SMART
low complexity region 1083 1097 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1158 1168 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000068415
AA Change: I1031F

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000069685
Gene: ENSMUSG00000026872
AA Change: I1031F

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
ZnF_C2H2 211 234 2.09e-3 SMART
ZnF_C2H2 241 263 9.88e-5 SMART
ZnF_C2H2 282 304 4.87e-4 SMART
ZnF_C2H2 310 330 1.86e1 SMART
low complexity region 352 364 N/A INTRINSIC
ZnF_C2H2 581 601 5.54e1 SMART
HOX 644 706 2.05e-3 SMART
low complexity region 778 808 N/A INTRINSIC
low complexity region 841 856 N/A INTRINSIC
low complexity region 870 881 N/A INTRINSIC
ZnF_C2H2 999 1021 4.47e-3 SMART
ZnF_C2H2 1027 1049 2.17e-1 SMART
ZnF_C2H2 1055 1076 1.89e-1 SMART
low complexity region 1083 1097 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1158 1168 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000076836
AA Change: I1030F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076111
Gene: ENSMUSG00000026872
AA Change: I1030F

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
ZnF_C2H2 210 233 2.09e-3 SMART
ZnF_C2H2 240 262 9.88e-5 SMART
ZnF_C2H2 281 303 4.87e-4 SMART
ZnF_C2H2 309 329 1.86e1 SMART
low complexity region 351 363 N/A INTRINSIC
ZnF_C2H2 580 600 5.54e1 SMART
HOX 643 705 2.05e-3 SMART
low complexity region 777 807 N/A INTRINSIC
low complexity region 840 855 N/A INTRINSIC
low complexity region 869 880 N/A INTRINSIC
ZnF_C2H2 998 1020 4.47e-3 SMART
ZnF_C2H2 1026 1048 2.17e-1 SMART
ZnF_C2H2 1054 1075 1.89e-1 SMART
low complexity region 1082 1096 N/A INTRINSIC
low complexity region 1133 1149 N/A INTRINSIC
low complexity region 1157 1167 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000176438
AA Change: I1031F

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000134849
Gene: ENSMUSG00000026872
AA Change: I1031F

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
ZnF_C2H2 211 234 2.09e-3 SMART
ZnF_C2H2 241 263 9.88e-5 SMART
ZnF_C2H2 282 304 4.87e-4 SMART
ZnF_C2H2 310 330 1.86e1 SMART
low complexity region 352 364 N/A INTRINSIC
ZnF_C2H2 581 601 5.54e1 SMART
HOX 644 706 2.05e-3 SMART
low complexity region 778 808 N/A INTRINSIC
low complexity region 841 856 N/A INTRINSIC
low complexity region 870 881 N/A INTRINSIC
ZnF_C2H2 999 1021 4.47e-3 SMART
ZnF_C2H2 1027 1049 2.17e-1 SMART
ZnF_C2H2 1055 1076 1.89e-1 SMART
low complexity region 1083 1097 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1158 1168 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176732
SMART Domains Protein: ENSMUSP00000135393
Gene: ENSMUSG00000026872

DomainStartEndE-ValueType
low complexity region 14 26 N/A INTRINSIC
ZnF_C2H2 60 83 2.09e-3 SMART
ZnF_C2H2 90 112 9.88e-5 SMART
ZnF_C2H2 131 153 4.87e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000177302
AA Change: I1031F

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000134747
Gene: ENSMUSG00000026872
AA Change: I1031F

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
ZnF_C2H2 211 234 2.09e-3 SMART
ZnF_C2H2 241 263 9.88e-5 SMART
ZnF_C2H2 282 304 4.87e-4 SMART
ZnF_C2H2 310 330 1.86e1 SMART
low complexity region 352 364 N/A INTRINSIC
ZnF_C2H2 581 601 5.54e1 SMART
HOX 644 706 2.05e-3 SMART
low complexity region 778 808 N/A INTRINSIC
low complexity region 841 856 N/A INTRINSIC
low complexity region 870 881 N/A INTRINSIC
ZnF_C2H2 999 1021 4.47e-3 SMART
ZnF_C2H2 1027 1049 2.17e-1 SMART
ZnF_C2H2 1055 1076 1.89e-1 SMART
low complexity region 1083 1097 N/A INTRINSIC
low complexity region 1134 1150 N/A INTRINSIC
low complexity region 1158 1168 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200844
AA Change: I1007F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144421
Gene: ENSMUSG00000026872
AA Change: I1007F

DomainStartEndE-ValueType
low complexity region 78 90 N/A INTRINSIC
ZnF_C2H2 187 210 9.2e-6 SMART
ZnF_C2H2 217 239 4.2e-7 SMART
ZnF_C2H2 258 280 2e-6 SMART
ZnF_C2H2 286 306 8e-2 SMART
low complexity region 328 340 N/A INTRINSIC
ZnF_C2H2 557 577 2.4e-1 SMART
HOX 620 682 1.1e-5 SMART
low complexity region 754 784 N/A INTRINSIC
low complexity region 817 832 N/A INTRINSIC
low complexity region 846 857 N/A INTRINSIC
ZnF_C2H2 975 997 1.9e-5 SMART
ZnF_C2H2 1003 1025 9.6e-4 SMART
ZnF_C2H2 1031 1052 7.9e-4 SMART
low complexity region 1059 1073 N/A INTRINSIC
low complexity region 1110 1126 N/A INTRINSIC
low complexity region 1134 1144 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Zfh1 family of 2-handed zinc finger/homeodomain proteins. It is located in the nucleus and functions as a DNA-binding transcriptional repressor that interacts with activated SMADs. Mutations in this gene are associated with Hirschsprung disease/Mowat-Wilson syndrome. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygous null mutants exhibit a variety of defects at embryonic day 8.5 and die between embryonic days 9.5 and 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,965,018 A403T Het
Abhd16b G A 2: 181,493,967 A221T probably damaging Het
Arhgef1 C T 7: 24,919,749 Q472* probably null Het
Arhgef1 C T 7: 24,907,662 probably benign Het
Calr3 C T 8: 72,427,179 G298S probably damaging Het
Chrng A G 1: 87,205,996 T15A unknown Het
CK137956 T A 4: 127,951,282 K223* probably null Het
Clca3b A T 3: 144,847,174 S97T probably benign Het
Cops7b G T 1: 86,587,194 G102V probably damaging Het
Dennd1a T A 2: 37,858,060 S382C probably damaging Het
Fdps G A 3: 89,099,386 Q66* probably null Het
Gemin4 T C 11: 76,212,913 T341A probably benign Het
Gm37596 G A 3: 93,692,145 Q306* probably null Het
Grk3 A G 5: 112,961,489 S201P unknown Het
Hgf C T 5: 16,602,331 T407I probably damaging Het
Hip1r C T 5: 123,997,227 R446C probably damaging Het
Hyal6 A T 6: 24,740,828 I327L possibly damaging Het
Ifna15 T C 4: 88,557,683 E188G possibly damaging Het
Igip A G 18: 36,301,213 S11G probably benign Het
Igkv5-39 A G 6: 69,900,605 Y56H probably damaging Het
Jph1 G A 1: 17,016,155 T381I probably damaging Het
Lrrc55 T C 2: 85,191,915 I311V probably benign Het
Mrps35 T A 6: 147,048,163 D58E probably benign Het
Ms4a4d C A 19: 11,557,946 P203T probably benign Het
Naip1 T G 13: 100,437,375 E225D possibly damaging Het
Ncapg2 T A 12: 116,444,347 I989N possibly damaging Het
Nek3 A T 8: 22,157,020 Y166* probably null Het
Nphs1 A G 7: 30,482,053 E1169G probably benign Het
Nudt15 G A 14: 73,521,659 P123L probably benign Het
Olfr1491 G A 19: 13,705,220 C131Y probably damaging Het
Olfr160 C T 9: 37,712,073 V69M probably benign Het
Olfr204 T C 16: 59,314,544 I288V possibly damaging Het
Olfr427 T A 1: 174,100,171 S238T probably damaging Het
Olfr95 T A 17: 37,211,316 E179V probably damaging Het
Pcdha5 T C 18: 36,960,641 S68P possibly damaging Het
Plec G T 15: 76,190,573 A330E unknown Het
Rpa3 A C 6: 8,256,790 I63S probably damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Snap25 A T 2: 136,769,828 K83N probably benign Het
Sos1 T G 17: 80,408,602 Q977P probably damaging Het
Spag16 A G 1: 70,381,302 Y483C probably damaging Het
Speg A G 1: 75,422,995 E2362G probably damaging Het
Swap70 A G 7: 110,255,877 D128G probably damaging Het
Syngap1 G A 17: 26,958,180 M545I probably damaging Het
Tmem147 T C 7: 30,728,447 E110G probably damaging Het
Tmem156 T A 5: 65,075,755 I155F probably benign Het
Trim25 C A 11: 89,016,606 A597E probably damaging Het
Ttc7b T C 12: 100,446,872 Y229C probably damaging Het
Utrn T A 10: 12,682,410 Q1435L probably damaging Het
Zbtb41 T C 1: 139,423,217 S23P probably benign Het
Other mutations in Zeb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00900:Zeb2 APN 2 44997275 missense probably damaging 1.00
IGL01639:Zeb2 APN 2 44997257 missense probably benign
IGL02016:Zeb2 APN 2 44988874 missense possibly damaging 0.71
IGL02337:Zeb2 APN 2 44997230 missense probably damaging 0.96
IGL02745:Zeb2 APN 2 44994475 unclassified probably benign
IGL02893:Zeb2 APN 2 44996607 missense probably benign 0.03
IGL03412:Zeb2 APN 2 45002708 intron probably benign
Dropped UTSW 2 45110041 missense possibly damaging 0.66
Okapi UTSW 2 44997156 missense probably damaging 1.00
sable UTSW 2 44997318 missense probably damaging 1.00
R0514:Zeb2 UTSW 2 45002647 missense possibly damaging 0.52
R0603:Zeb2 UTSW 2 45017426 missense probably benign 0.45
R0608:Zeb2 UTSW 2 44996126 missense possibly damaging 0.87
R1236:Zeb2 UTSW 2 44994646 missense probably damaging 1.00
R1529:Zeb2 UTSW 2 44997194 missense probably damaging 1.00
R1581:Zeb2 UTSW 2 44997000 missense probably damaging 0.99
R1636:Zeb2 UTSW 2 45002611 missense probably damaging 1.00
R1924:Zeb2 UTSW 2 45002612 missense probably damaging 1.00
R2012:Zeb2 UTSW 2 44997950 missense probably damaging 1.00
R2097:Zeb2 UTSW 2 44997156 missense probably damaging 1.00
R2156:Zeb2 UTSW 2 44988809 missense probably benign 0.20
R4385:Zeb2 UTSW 2 45023062 missense probably damaging 1.00
R4472:Zeb2 UTSW 2 45023011 missense probably damaging 1.00
R4678:Zeb2 UTSW 2 44996341 missense probably damaging 0.99
R4769:Zeb2 UTSW 2 44996435 missense probably damaging 1.00
R4816:Zeb2 UTSW 2 44997768 missense probably damaging 0.99
R4918:Zeb2 UTSW 2 44996882 missense probably damaging 1.00
R4969:Zeb2 UTSW 2 44998919 missense probably damaging 1.00
R5191:Zeb2 UTSW 2 45002600 missense probably benign 0.00
R5195:Zeb2 UTSW 2 45001635 missense probably damaging 1.00
R5322:Zeb2 UTSW 2 44997095 missense probably damaging 1.00
R5699:Zeb2 UTSW 2 44997788 missense probably damaging 1.00
R5750:Zeb2 UTSW 2 44997518 missense probably damaging 0.96
R5764:Zeb2 UTSW 2 44996919 missense possibly damaging 0.89
R5914:Zeb2 UTSW 2 44997052 missense probably benign 0.00
R5918:Zeb2 UTSW 2 45111259 intron probably benign
R6037:Zeb2 UTSW 2 44988640 nonsense probably null
R6037:Zeb2 UTSW 2 44988640 nonsense probably null
R6302:Zeb2 UTSW 2 44997759 missense probably benign 0.18
R6372:Zeb2 UTSW 2 45002539 missense probably damaging 1.00
R6402:Zeb2 UTSW 2 44996975 missense probably damaging 1.00
R6492:Zeb2 UTSW 2 45110496 intron probably benign
R6554:Zeb2 UTSW 2 44997512 missense probably damaging 1.00
R6675:Zeb2 UTSW 2 44997445 nonsense probably null
R6735:Zeb2 UTSW 2 45110016 missense probably null 0.99
R6870:Zeb2 UTSW 2 44988910 missense probably damaging 0.98
R6925:Zeb2 UTSW 2 44994529 missense probably damaging 1.00
R6963:Zeb2 UTSW 2 44988799 missense probably damaging 0.97
R6972:Zeb2 UTSW 2 44997318 missense probably damaging 1.00
R7144:Zeb2 UTSW 2 45110041 missense possibly damaging 0.66
R7178:Zeb2 UTSW 2 44996994 missense probably damaging 0.97
R7379:Zeb2 UTSW 2 45001817 splice site probably null
R7419:Zeb2 UTSW 2 44996347 missense probably benign 0.20
R7580:Zeb2 UTSW 2 44994532 missense probably damaging 1.00
R7599:Zeb2 UTSW 2 44994613 missense probably damaging 1.00
R7625:Zeb2 UTSW 2 45002572 missense probably damaging 1.00
R7917:Zeb2 UTSW 2 44996409 missense possibly damaging 0.50
R8412:Zeb2 UTSW 2 44998952 missense probably damaging 1.00
R8413:Zeb2 UTSW 2 44996171 missense probably damaging 0.99
R8417:Zeb2 UTSW 2 45022996 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGGTTCCAAGTGCCCTTTC -3'
(R):5'- AAATGGACCTTCCTAACCGACTTG -3'

Sequencing Primer
(F):5'- AAGTGCCCTTTCTCTCGCG -3'
(R):5'- ACCGACTTGGGTTAGACCG -3'
Posted On2020-06-30