Incidental Mutation 'R8132:Abhd16b'
ID632056
Institutional Source Beutler Lab
Gene Symbol Abhd16b
Ensembl Gene ENSMUSG00000055882
Gene Nameabhydrolase domain containing 16B
SynonymsBC050777
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R8132 (G1)
Quality Score215.009
Status Not validated
Chromosome2
Chromosomal Location181493206-181494980 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 181493967 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 221 (A221T)
Ref Sequence ENSEMBL: ENSMUSP00000066520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000844] [ENSMUST00000069649] [ENSMUST00000069712] [ENSMUST00000108799] [ENSMUST00000108800] [ENSMUST00000149163] [ENSMUST00000184588] [ENSMUST00000184849]
Predicted Effect probably benign
Transcript: ENSMUST00000000844
SMART Domains Protein: ENSMUSP00000000844
Gene: ENSMUSG00000000827

DomainStartEndE-ValueType
Pfam:TPD52 28 199 6.2e-55 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000069649
AA Change: A221T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066520
Gene: ENSMUSG00000055882
AA Change: A221T

DomainStartEndE-ValueType
Pfam:Abhydrolase_1 174 339 2.9e-11 PFAM
Pfam:Abhydrolase_5 174 341 2.1e-13 PFAM
Pfam:Hydrolase_4 180 308 5.1e-9 PFAM
low complexity region 345 357 N/A INTRINSIC
low complexity region 435 452 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000069712
SMART Domains Protein: ENSMUSP00000068888
Gene: ENSMUSG00000000827

DomainStartEndE-ValueType
Pfam:TPD52 27 193 5.8e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108799
SMART Domains Protein: ENSMUSP00000104427
Gene: ENSMUSG00000000827

DomainStartEndE-ValueType
Pfam:TPD52 18 121 1.9e-38 PFAM
Pfam:TPD52 115 220 1.3e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108800
SMART Domains Protein: ENSMUSP00000104428
Gene: ENSMUSG00000000827

DomainStartEndE-ValueType
Pfam:TPD52 27 179 2.9e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149163
SMART Domains Protein: ENSMUSP00000117690
Gene: ENSMUSG00000000827

DomainStartEndE-ValueType
Pfam:TPD52 28 213 5.2e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184588
Predicted Effect probably benign
Transcript: ENSMUST00000184849
SMART Domains Protein: ENSMUSP00000138837
Gene: ENSMUSG00000000827

DomainStartEndE-ValueType
Pfam:TPD52 9 170 2.4e-54 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,965,018 A403T Het
Arhgef1 C T 7: 24,919,749 Q472* probably null Het
Arhgef1 C T 7: 24,907,662 probably benign Het
Calr3 C T 8: 72,427,179 G298S probably damaging Het
Chrng A G 1: 87,205,996 T15A unknown Het
CK137956 T A 4: 127,951,282 K223* probably null Het
Clca3b A T 3: 144,847,174 S97T probably benign Het
Cops7b G T 1: 86,587,194 G102V probably damaging Het
Dennd1a T A 2: 37,858,060 S382C probably damaging Het
Fdps G A 3: 89,099,386 Q66* probably null Het
Gemin4 T C 11: 76,212,913 T341A probably benign Het
Gm37596 G A 3: 93,692,145 Q306* probably null Het
Grk3 A G 5: 112,961,489 S201P unknown Het
Hgf C T 5: 16,602,331 T407I probably damaging Het
Hip1r C T 5: 123,997,227 R446C probably damaging Het
Hyal6 A T 6: 24,740,828 I327L possibly damaging Het
Ifna15 T C 4: 88,557,683 E188G possibly damaging Het
Igip A G 18: 36,301,213 S11G probably benign Het
Igkv5-39 A G 6: 69,900,605 Y56H probably damaging Het
Jph1 G A 1: 17,016,155 T381I probably damaging Het
Lrrc55 T C 2: 85,191,915 I311V probably benign Het
Mrps35 T A 6: 147,048,163 D58E probably benign Het
Ms4a4d C A 19: 11,557,946 P203T probably benign Het
Naip1 T G 13: 100,437,375 E225D possibly damaging Het
Ncapg2 T A 12: 116,444,347 I989N possibly damaging Het
Nek3 A T 8: 22,157,020 Y166* probably null Het
Nphs1 A G 7: 30,482,053 E1169G probably benign Het
Nudt15 G A 14: 73,521,659 P123L probably benign Het
Olfr1491 G A 19: 13,705,220 C131Y probably damaging Het
Olfr160 C T 9: 37,712,073 V69M probably benign Het
Olfr204 T C 16: 59,314,544 I288V possibly damaging Het
Olfr427 T A 1: 174,100,171 S238T probably damaging Het
Olfr95 T A 17: 37,211,316 E179V probably damaging Het
Pcdha5 T C 18: 36,960,641 S68P possibly damaging Het
Plec G T 15: 76,190,573 A330E unknown Het
Rpa3 A C 6: 8,256,790 I63S probably damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Snap25 A T 2: 136,769,828 K83N probably benign Het
Sos1 T G 17: 80,408,602 Q977P probably damaging Het
Spag16 A G 1: 70,381,302 Y483C probably damaging Het
Speg A G 1: 75,422,995 E2362G probably damaging Het
Swap70 A G 7: 110,255,877 D128G probably damaging Het
Syngap1 G A 17: 26,958,180 M545I probably damaging Het
Tmem147 T C 7: 30,728,447 E110G probably damaging Het
Tmem156 T A 5: 65,075,755 I155F probably benign Het
Trim25 C A 11: 89,016,606 A597E probably damaging Het
Ttc7b T C 12: 100,446,872 Y229C probably damaging Het
Utrn T A 10: 12,682,410 Q1435L probably damaging Het
Zbtb41 T C 1: 139,423,217 S23P probably benign Het
Zeb2 T A 2: 44,989,130 I1075F probably damaging Het
Other mutations in Abhd16b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01651:Abhd16b APN 2 181494738 unclassified probably benign
IGL02237:Abhd16b APN 2 181493557 missense probably benign 0.00
IGL02457:Abhd16b APN 2 181494334 missense probably benign 0.00
PIT4486001:Abhd16b UTSW 2 181493959 missense probably benign 0.39
R1760:Abhd16b UTSW 2 181493404 missense probably damaging 1.00
R2077:Abhd16b UTSW 2 181493416 missense probably benign 0.44
R3124:Abhd16b UTSW 2 181494526 missense possibly damaging 0.70
R4779:Abhd16b UTSW 2 181493460 missense possibly damaging 0.59
R5781:Abhd16b UTSW 2 181494154 missense probably damaging 1.00
R6220:Abhd16b UTSW 2 181493785 missense probably damaging 1.00
R6994:Abhd16b UTSW 2 181493668 missense possibly damaging 0.94
R7305:Abhd16b UTSW 2 181493416 missense possibly damaging 0.85
R7850:Abhd16b UTSW 2 181493725 missense not run
R8115:Abhd16b UTSW 2 181493734 missense possibly damaging 0.55
R8214:Abhd16b UTSW 2 181494190 missense probably damaging 1.00
X0052:Abhd16b UTSW 2 181494265 missense probably damaging 1.00
X0066:Abhd16b UTSW 2 181493713 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- TGACACCATGTTCATGGATCGC -3'
(R):5'- ACTCTGGGGCATAACCTTCAG -3'

Sequencing Primer
(F):5'- CATGTTCATGGATCGCCGTCAG -3'
(R):5'- ATAACCTTCAGCGCTAGTGG -3'
Posted On2020-06-30