Incidental Mutation 'R8132:Fdps'
ID632057
Institutional Source Beutler Lab
Gene Symbol Fdps
Ensembl Gene ENSMUSG00000059743
Gene Namefarnesyl diphosphate synthetase
Synonyms6030492I17Rik, Fdpsl1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R8132 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location89093588-89101959 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 89099386 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 66 (Q66*)
Ref Sequence ENSEMBL: ENSMUSP00000080531 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081848] [ENSMUST00000196254] [ENSMUST00000196709] [ENSMUST00000196921] [ENSMUST00000199668] [ENSMUST00000200659]
Predicted Effect probably null
Transcript: ENSMUST00000081848
AA Change: Q66*
SMART Domains Protein: ENSMUSP00000080531
Gene: ENSMUSG00000059743
AA Change: Q66*

DomainStartEndE-ValueType
Pfam:polyprenyl_synt 47 313 2e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196254
SMART Domains Protein: ENSMUSP00000142669
Gene: ENSMUSG00000059743

DomainStartEndE-ValueType
Pfam:polyprenyl_synt 1 238 3.6e-60 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000196709
AA Change: Q66*
SMART Domains Protein: ENSMUSP00000142770
Gene: ENSMUSG00000059743
AA Change: Q66*

DomainStartEndE-ValueType
Pfam:polyprenyl_synt 44 316 8.7e-84 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000196921
AA Change: Q133*
SMART Domains Protein: ENSMUSP00000142704
Gene: ENSMUSG00000059743
AA Change: Q133*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:polyprenyl_synt 111 226 7.9e-30 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000199668
AA Change: Q66*
SMART Domains Protein: ENSMUSP00000142393
Gene: ENSMUSG00000059743
AA Change: Q66*

DomainStartEndE-ValueType
Pfam:polyprenyl_synt 44 121 3.2e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000200659
AA Change: Q133*
SMART Domains Protein: ENSMUSP00000142694
Gene: ENSMUSG00000105204
AA Change: Q133*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:polyprenyl_synt 111 334 3.2e-55 PFAM
low complexity region 548 559 N/A INTRINSIC
RUN 560 628 9.3e-19 SMART
low complexity region 640 654 N/A INTRINSIC
low complexity region 673 685 N/A INTRINSIC
low complexity region 724 741 N/A INTRINSIC
SH3 809 862 2.8e-10 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that catalyzes the production of geranyl pyrophosphate and farnesyl pyrophosphate from isopentenyl pyrophosphate and dimethylallyl pyrophosphate. The resulting product, farnesyl pyrophosphate, is a key intermediate in cholesterol and sterol biosynthesis, a substrate for protein farnesylation and geranylgeranylation, and a ligand or agonist for certain hormone receptors and growth receptors. Drugs that inhibit this enzyme prevent the post-translational modifications of small GTPases and have been used to treat diseases related to bone resorption. Multiple pseudogenes have been found on chromosomes 1, 7, 14, 15, 21 and X. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,965,018 A403T Het
Abhd16b G A 2: 181,493,967 A221T probably damaging Het
Arhgef1 C T 7: 24,907,662 probably benign Het
Arhgef1 C T 7: 24,919,749 Q472* probably null Het
Calr3 C T 8: 72,427,179 G298S probably damaging Het
Chrng A G 1: 87,205,996 T15A unknown Het
CK137956 T A 4: 127,951,282 K223* probably null Het
Clca3b A T 3: 144,847,174 S97T probably benign Het
Cops7b G T 1: 86,587,194 G102V probably damaging Het
Dennd1a T A 2: 37,858,060 S382C probably damaging Het
Gemin4 T C 11: 76,212,913 T341A probably benign Het
Gm37596 G A 3: 93,692,145 Q306* probably null Het
Grk3 A G 5: 112,961,489 S201P unknown Het
Hgf C T 5: 16,602,331 T407I probably damaging Het
Hip1r C T 5: 123,997,227 R446C probably damaging Het
Hyal6 A T 6: 24,740,828 I327L possibly damaging Het
Ifna15 T C 4: 88,557,683 E188G possibly damaging Het
Igip A G 18: 36,301,213 S11G probably benign Het
Igkv5-39 A G 6: 69,900,605 Y56H probably damaging Het
Jph1 G A 1: 17,016,155 T381I probably damaging Het
Lrrc55 T C 2: 85,191,915 I311V probably benign Het
Mrps35 T A 6: 147,048,163 D58E probably benign Het
Ms4a4d C A 19: 11,557,946 P203T probably benign Het
Naip1 T G 13: 100,437,375 E225D possibly damaging Het
Ncapg2 T A 12: 116,444,347 I989N possibly damaging Het
Nek3 A T 8: 22,157,020 Y166* probably null Het
Nphs1 A G 7: 30,482,053 E1169G probably benign Het
Nudt15 G A 14: 73,521,659 P123L probably benign Het
Olfr1491 G A 19: 13,705,220 C131Y probably damaging Het
Olfr160 C T 9: 37,712,073 V69M probably benign Het
Olfr204 T C 16: 59,314,544 I288V possibly damaging Het
Olfr427 T A 1: 174,100,171 S238T probably damaging Het
Olfr95 T A 17: 37,211,316 E179V probably damaging Het
Pcdha5 T C 18: 36,960,641 S68P possibly damaging Het
Plec G T 15: 76,190,573 A330E unknown Het
Rpa3 A C 6: 8,256,790 I63S probably damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Snap25 A T 2: 136,769,828 K83N probably benign Het
Sos1 T G 17: 80,408,602 Q977P probably damaging Het
Spag16 A G 1: 70,381,302 Y483C probably damaging Het
Speg A G 1: 75,422,995 E2362G probably damaging Het
Swap70 A G 7: 110,255,877 D128G probably damaging Het
Syngap1 G A 17: 26,958,180 M545I probably damaging Het
Tmem147 T C 7: 30,728,447 E110G probably damaging Het
Tmem156 T A 5: 65,075,755 I155F probably benign Het
Trim25 C A 11: 89,016,606 A597E probably damaging Het
Ttc7b T C 12: 100,446,872 Y229C probably damaging Het
Utrn T A 10: 12,682,410 Q1435L probably damaging Het
Zbtb41 T C 1: 139,423,217 S23P probably benign Het
Zeb2 T A 2: 44,989,130 I1075F probably damaging Het
Other mutations in Fdps
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Fdps APN 3 89094442 splice site probably benign
IGL01364:Fdps APN 3 89094270 nonsense probably null
broadside UTSW 3 89100761 missense probably damaging 1.00
R0245:Fdps UTSW 3 89093771 missense possibly damaging 0.84
R0385:Fdps UTSW 3 89094894 missense probably damaging 1.00
R1674:Fdps UTSW 3 89100730 missense probably benign 0.33
R1820:Fdps UTSW 3 89095043 missense probably benign
R4467:Fdps UTSW 3 89100786 missense possibly damaging 0.71
R5106:Fdps UTSW 3 89099403 missense probably damaging 0.99
R5700:Fdps UTSW 3 89095649 missense probably damaging 1.00
R6128:Fdps UTSW 3 89099433 missense possibly damaging 0.77
R6791:Fdps UTSW 3 89095352 critical splice donor site probably null
R6800:Fdps UTSW 3 89100761 missense probably damaging 1.00
R6812:Fdps UTSW 3 89094476 missense possibly damaging 0.51
R6927:Fdps UTSW 3 89093651 missense probably benign 0.41
R7585:Fdps UTSW 3 89093806 missense probably benign 0.17
R7599:Fdps UTSW 3 89099386 missense probably benign 0.05
R7691:Fdps UTSW 3 89099367 missense probably benign 0.01
R7709:Fdps UTSW 3 89101090 missense probably damaging 0.97
R8035:Fdps UTSW 3 89095476 missense probably benign 0.04
R8297:Fdps UTSW 3 89093741 missense probably damaging 0.99
R8323:Fdps UTSW 3 89095389 missense possibly damaging 0.93
X0060:Fdps UTSW 3 89094314 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- TGTGACTACAGCACACAAGAG -3'
(R):5'- CAGCCCATAGGATGTTGGAG -3'

Sequencing Primer
(F):5'- TGACTACAGCACACAAGAGACACAG -3'
(R):5'- CCCATAGGATGTTGGAGAGGGAATG -3'
Posted On2020-06-30