Incidental Mutation 'R8132:Hgf'
ID632062
Institutional Source Beutler Lab
Gene Symbol Hgf
Ensembl Gene ENSMUSG00000028864
Gene Namehepatocyte growth factor
SynonymsHGF/SF, NK1, C230052L06Rik, scatter factor, NK2, SF/HGF
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8132 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location16553495-16620152 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 16602331 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 407 (T407I)
Ref Sequence ENSEMBL: ENSMUSP00000030683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030683] [ENSMUST00000196645] [ENSMUST00000199581]
PDB Structure
A Mechanistic Basis for Converting a Receptor Tyrosine Kinase Agonist to an Antagonist [X-RAY DIFFRACTION]
Crystal structure of the N-terminal fragment (31-127) of the mouse hepatocyte growth factor/scatter factor [X-RAY DIFFRACTION]
Crystal Structure of the NK2 Fragment (31-290) of the mouse Hepatocyte Growth Factor/Scatter Factor [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000030683
AA Change: T407I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030683
Gene: ENSMUSG00000028864
AA Change: T407I

DomainStartEndE-ValueType
low complexity region 7 25 N/A INTRINSIC
PAN_AP 38 123 6.47e-13 SMART
KR 127 209 3.03e-46 SMART
KR 210 291 9.04e-45 SMART
KR 304 386 7.35e-45 SMART
KR 390 472 1.02e-38 SMART
Tryp_SPc 495 719 5.6e-55 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000196645
AA Change: T402I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142517
Gene: ENSMUSG00000028864
AA Change: T402I

DomainStartEndE-ValueType
low complexity region 7 25 N/A INTRINSIC
PAN_AP 38 123 6.47e-13 SMART
KR 127 204 3.76e-42 SMART
KR 205 286 9.04e-45 SMART
KR 299 381 7.35e-45 SMART
KR 385 467 1.02e-38 SMART
Tryp_SPc 490 714 5.6e-55 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000199581
AA Change: T407I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143424
Gene: ENSMUSG00000028864
AA Change: T407I

DomainStartEndE-ValueType
low complexity region 7 25 N/A INTRINSIC
PAN_AP 38 123 6.47e-13 SMART
KR 127 209 3.03e-46 SMART
KR 210 291 9.04e-45 SMART
KR 304 386 7.35e-45 SMART
KR 390 472 1.02e-38 SMART
Tryp_SPc 495 719 5.6e-55 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that binds to the hepatocyte growth factor receptor to regulate cell growth, cell motility and morphogenesis in numerous cell and tissue types. The encoded preproprotein is proteolytically processed to generate multiple protein products, including the hepatocyte growth factor alpha and beta chains, which heterodimerize to form the mature active protein. Although this protein is a member of the peptidase S1 family of serine proteases, it lacks peptidase activity. Homozygous knockout mice for this gene exhibit embryonic lethality due to impaired development of the placenta and liver. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced embryonic livers, impaired migration of dermomyotome precursors affecting skeletal muscle formation, defective navigation of hypoglossal motor axons, abnormal placentas, and prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,965,018 A403T Het
Abhd16b G A 2: 181,493,967 A221T probably damaging Het
Arhgef1 C T 7: 24,919,749 Q472* probably null Het
Arhgef1 C T 7: 24,907,662 probably benign Het
Calr3 C T 8: 72,427,179 G298S probably damaging Het
Chrng A G 1: 87,205,996 T15A unknown Het
CK137956 T A 4: 127,951,282 K223* probably null Het
Clca3b A T 3: 144,847,174 S97T probably benign Het
Cops7b G T 1: 86,587,194 G102V probably damaging Het
Dennd1a T A 2: 37,858,060 S382C probably damaging Het
Fdps G A 3: 89,099,386 Q66* probably null Het
Gemin4 T C 11: 76,212,913 T341A probably benign Het
Gm37596 G A 3: 93,692,145 Q306* probably null Het
Grk3 A G 5: 112,961,489 S201P unknown Het
Hip1r C T 5: 123,997,227 R446C probably damaging Het
Hyal6 A T 6: 24,740,828 I327L possibly damaging Het
Ifna15 T C 4: 88,557,683 E188G possibly damaging Het
Igip A G 18: 36,301,213 S11G probably benign Het
Igkv5-39 A G 6: 69,900,605 Y56H probably damaging Het
Jph1 G A 1: 17,016,155 T381I probably damaging Het
Lrrc55 T C 2: 85,191,915 I311V probably benign Het
Mrps35 T A 6: 147,048,163 D58E probably benign Het
Ms4a4d C A 19: 11,557,946 P203T probably benign Het
Naip1 T G 13: 100,437,375 E225D possibly damaging Het
Ncapg2 T A 12: 116,444,347 I989N possibly damaging Het
Nek3 A T 8: 22,157,020 Y166* probably null Het
Nphs1 A G 7: 30,482,053 E1169G probably benign Het
Nudt15 G A 14: 73,521,659 P123L probably benign Het
Olfr1491 G A 19: 13,705,220 C131Y probably damaging Het
Olfr160 C T 9: 37,712,073 V69M probably benign Het
Olfr204 T C 16: 59,314,544 I288V possibly damaging Het
Olfr427 T A 1: 174,100,171 S238T probably damaging Het
Olfr95 T A 17: 37,211,316 E179V probably damaging Het
Pcdha5 T C 18: 36,960,641 S68P possibly damaging Het
Plec G T 15: 76,190,573 A330E unknown Het
Rpa3 A C 6: 8,256,790 I63S probably damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Snap25 A T 2: 136,769,828 K83N probably benign Het
Sos1 T G 17: 80,408,602 Q977P probably damaging Het
Spag16 A G 1: 70,381,302 Y483C probably damaging Het
Speg A G 1: 75,422,995 E2362G probably damaging Het
Swap70 A G 7: 110,255,877 D128G probably damaging Het
Syngap1 G A 17: 26,958,180 M545I probably damaging Het
Tmem147 T C 7: 30,728,447 E110G probably damaging Het
Tmem156 T A 5: 65,075,755 I155F probably benign Het
Trim25 C A 11: 89,016,606 A597E probably damaging Het
Ttc7b T C 12: 100,446,872 Y229C probably damaging Het
Utrn T A 10: 12,682,410 Q1435L probably damaging Het
Zbtb41 T C 1: 139,423,217 S23P probably benign Het
Zeb2 T A 2: 44,989,130 I1075F probably damaging Het
Other mutations in Hgf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Hgf APN 5 16611882 missense possibly damaging 0.70
IGL00427:Hgf APN 5 16578486 missense probably benign 0.09
IGL00788:Hgf APN 5 16598230 missense probably damaging 0.99
IGL01290:Hgf APN 5 16604846 missense probably damaging 1.00
IGL01333:Hgf APN 5 16576941 nonsense probably null
IGL01568:Hgf APN 5 16564814 missense probably damaging 1.00
IGL02314:Hgf APN 5 16572602 missense probably damaging 0.99
IGL02328:Hgf APN 5 16598221 missense probably damaging 1.00
IGL02368:Hgf APN 5 16564794 missense possibly damaging 0.95
IGL02486:Hgf APN 5 16602289 missense probably damaging 1.00
IGL02654:Hgf APN 5 16561051 missense probably benign
Foiegras UTSW 5 16615802 missense probably benign 0.01
PIT4378001:Hgf UTSW 5 16611862 missense probably damaging 1.00
R0708:Hgf UTSW 5 16566763 nonsense probably null
R0710:Hgf UTSW 5 16566763 nonsense probably null
R0718:Hgf UTSW 5 16593859 missense probably damaging 1.00
R0967:Hgf UTSW 5 16593841 splice site probably benign
R1181:Hgf UTSW 5 16618925 missense probably damaging 1.00
R1589:Hgf UTSW 5 16613785 missense probably damaging 1.00
R1705:Hgf UTSW 5 16615802 missense probably benign 0.01
R1983:Hgf UTSW 5 16561012 missense possibly damaging 0.53
R2021:Hgf UTSW 5 16576921 missense probably benign
R2441:Hgf UTSW 5 16604790 missense probably damaging 0.99
R4083:Hgf UTSW 5 16615858 nonsense probably null
R4084:Hgf UTSW 5 16615858 nonsense probably null
R4211:Hgf UTSW 5 16614993 missense probably damaging 0.99
R4388:Hgf UTSW 5 16614943 missense probably benign 0.12
R4394:Hgf UTSW 5 16618951 nonsense probably null
R4575:Hgf UTSW 5 16572601 missense probably benign
R5044:Hgf UTSW 5 16614894 missense probably benign 0.00
R5319:Hgf UTSW 5 16566862 critical splice donor site probably null
R5585:Hgf UTSW 5 16564801 missense possibly damaging 0.93
R5700:Hgf UTSW 5 16610124 missense probably damaging 1.00
R5814:Hgf UTSW 5 16602307 missense probably benign 0.19
R6125:Hgf UTSW 5 16598161 missense probably damaging 1.00
R6749:Hgf UTSW 5 16613642 splice site probably null
R6891:Hgf UTSW 5 16604922 critical splice donor site probably null
R6962:Hgf UTSW 5 16615754 missense probably benign 0.32
R7251:Hgf UTSW 5 16593944 missense possibly damaging 0.95
R7296:Hgf UTSW 5 16564843 missense probably benign 0.39
R7463:Hgf UTSW 5 16578450 missense probably benign 0.00
R7470:Hgf UTSW 5 16618856 missense probably benign 0.02
R7630:Hgf UTSW 5 16598250 missense probably benign 0.01
R7807:Hgf UTSW 5 16577011 missense probably damaging 0.99
R8098:Hgf UTSW 5 16561061 missense probably benign 0.04
R8120:Hgf UTSW 5 16613781 missense probably damaging 1.00
X0024:Hgf UTSW 5 16604828 missense probably damaging 1.00
Z1088:Hgf UTSW 5 16618919 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGAGTTGCCTGCCTGCTTG -3'
(R):5'- CCCTACAGCATCTATTATGGTTCAG -3'

Sequencing Primer
(F):5'- AATTGTGAGGGGTTTTGGAATC -3'
(R):5'- GGCTCCCTCTGTTAAAGAAT -3'
Posted On2020-06-30