Mutagenetix > Incidental Mutations

Incidental Mutation 'R8132:Grk3'

632064

Institutional Source

Beutler Lab

Gene Symbol

Grk3

Ensembl Gene

ENSMUSG00000042249

Gene Name

G protein-coupled receptor kinase 3

Synonyms

4833444A01Rik, Bark-2, Adrbk-2, Adrbk2, beta ARK2

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8132 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

112910482-113015791 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 112961489 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 201 (S201P)

Ref Sequence

ENSEMBL: ENSMUSP00000143427 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065167] [ENSMUST00000197776] [ENSMUST00000197888] [ENSMUST00000200332]

Predicted Effect

probably benign
Transcript: ENSMUST00000065167

SMART Domains

Protein: ENSMUSP00000070445
Gene: ENSMUSG00000042249

Domain	Start	End	E-Value	Type
RGS	54	175	1.44e-28	SMART
S_TKc	191	453	8.94e-85	SMART
S_TK_X	454	530	2.19e-10	SMART
PH	559	654	8.45e-12	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000197776
AA Change: S201P

SMART Domains

Protein: ENSMUSP00000143427
Gene: ENSMUSG00000042249
AA Change: S201P

Domain	Start	End	E-Value	Type
RGS	54	170	7.71e-20	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000197888

SMART Domains

Protein: ENSMUSP00000142968
Gene: ENSMUSG00000042249

Domain	Start	End	E-Value	Type
RGS	12	133	1.44e-28	SMART
S_TKc	149	411	8.94e-85	SMART
S_TK_X	412	488	2.19e-10	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000200332

SMART Domains

Protein: ENSMUSP00000142926
Gene: ENSMUSG00000042249

Domain	Start	End	E-Value	Type
PDB:3V5W\|A	1	88	6e-42	PDB
SCOP:d1dk8a_	48	88	2e-4	SMART
Blast:RGS	54	88	1e-18	BLAST

Coding Region Coverage

1x: 99.8%
3x: 99.6%
10x: 98.6%
20x: 94.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The beta-adrenergic receptor kinase specifically phosphorylates the agonist-occupied form of the beta-adrenergic and related G protein-coupled receptors. Overall, the beta adrenergic receptor kinase 2 has 85% amino acid similarity with beta adrenergic receptor kinase 1, with the protein kinase catalytic domain having 95% similarity. These data suggest the existence of a family of receptor kinases which may serve broadly to regulate receptor function. [provided by RefSeq, Jul 2008]
PHENOTYPE: Animals homozygous for a mutation of this gene appear normal and are fertile, but exhibit a lack of odorant receptor-mediated desensitization in the olfactory epithelium. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb10	C	T	8: 123,965,018	A403T		Het
Abhd16b	G	A	2: 181,493,967	A221T	probably damaging	Het
Arhgef1	C	T	7: 24,919,749	Q472*	probably null	Het
Arhgef1	C	T	7: 24,907,662		probably benign	Het
Calr3	C	T	8: 72,427,179	G298S	probably damaging	Het
Chrng	A	G	1: 87,205,996	T15A	unknown	Het
CK137956	T	A	4: 127,951,282	K223*	probably null	Het
Clca3b	A	T	3: 144,847,174	S97T	probably benign	Het
Cops7b	G	T	1: 86,587,194	G102V	probably damaging	Het
Dennd1a	T	A	2: 37,858,060	S382C	probably damaging	Het
Fdps	G	A	3: 89,099,386	Q66*	probably null	Het
Gemin4	T	C	11: 76,212,913	T341A	probably benign	Het
Gm37596	G	A	3: 93,692,145	Q306*	probably null	Het
Hgf	C	T	5: 16,602,331	T407I	probably damaging	Het
Hip1r	C	T	5: 123,997,227	R446C	probably damaging	Het
Hyal6	A	T	6: 24,740,828	I327L	possibly damaging	Het
Ifna15	T	C	4: 88,557,683	E188G	possibly damaging	Het
Igip	A	G	18: 36,301,213	S11G	probably benign	Het
Igkv5-39	A	G	6: 69,900,605	Y56H	probably damaging	Het
Jph1	G	A	1: 17,016,155	T381I	probably damaging	Het
Lrrc55	T	C	2: 85,191,915	I311V	probably benign	Het
Mrps35	T	A	6: 147,048,163	D58E	probably benign	Het
Ms4a4d	C	A	19: 11,557,946	P203T	probably benign	Het
Naip1	T	G	13: 100,437,375	E225D	possibly damaging	Het
Ncapg2	T	A	12: 116,444,347	I989N	possibly damaging	Het
Nek3	A	T	8: 22,157,020	Y166*	probably null	Het
Nphs1	A	G	7: 30,482,053	E1169G	probably benign	Het
Nudt15	G	A	14: 73,521,659	P123L	probably benign	Het
Olfr1491	G	A	19: 13,705,220	C131Y	probably damaging	Het
Olfr160	C	T	9: 37,712,073	V69M	probably benign	Het
Olfr204	T	C	16: 59,314,544	I288V	possibly damaging	Het
Olfr427	T	A	1: 174,100,171	S238T	probably damaging	Het
Olfr95	T	A	17: 37,211,316	E179V	probably damaging	Het
Pcdha5	T	C	18: 36,960,641	S68P	possibly damaging	Het
Plec	G	T	15: 76,190,573	A330E	unknown	Het
Rpa3	A	C	6: 8,256,790	I63S	probably damaging	Het
Rsf1	CG	CGACGGCGGGG	7: 97,579,908		probably benign	Het
Snap25	A	T	2: 136,769,828	K83N	probably benign	Het
Sos1	T	G	17: 80,408,602	Q977P	probably damaging	Het
Spag16	A	G	1: 70,381,302	Y483C	probably damaging	Het
Speg	A	G	1: 75,422,995	E2362G	probably damaging	Het
Swap70	A	G	7: 110,255,877	D128G	probably damaging	Het
Syngap1	G	A	17: 26,958,180	M545I	probably damaging	Het
Tmem147	T	C	7: 30,728,447	E110G	probably damaging	Het
Tmem156	T	A	5: 65,075,755	I155F	probably benign	Het
Trim25	C	A	11: 89,016,606	A597E	probably damaging	Het
Ttc7b	T	C	12: 100,446,872	Y229C	probably damaging	Het
Utrn	T	A	10: 12,682,410	Q1435L	probably damaging	Het
Zbtb41	T	C	1: 139,423,217	S23P	probably benign	Het
Zeb2	T	A	2: 44,989,130	I1075F	probably damaging	Het

Other mutations in Grk3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00974:Grk3	APN	5	112985819	missense	probably damaging	1.00
IGL01359:Grk3	APN	5	112937760	missense	probably damaging	1.00
IGL02318:Grk3	APN	5	112937803	missense	probably damaging	1.00
IGL02612:Grk3	APN	5	112969234	missense	probably benign	0.27
R0142:Grk3	UTSW	5	112915053	missense	probably damaging	1.00
R0589:Grk3	UTSW	5	112928763	splice site	probably benign
R0607:Grk3	UTSW	5	112920053	missense	probably damaging	1.00
R1459:Grk3	UTSW	5	112915012	missense	probably benign	0.10
R1554:Grk3	UTSW	5	112969269	missense	possibly damaging	0.76
R1640:Grk3	UTSW	5	113015382	missense	probably benign	0.36
R1657:Grk3	UTSW	5	112966982	missense	probably damaging	1.00
R1789:Grk3	UTSW	5	112941718	missense	probably damaging	1.00
R2401:Grk3	UTSW	5	112914983	missense	probably benign
R3735:Grk3	UTSW	5	112953831	missense	probably benign	0.00
R4024:Grk3	UTSW	5	112914984	missense	possibly damaging	0.77
R4025:Grk3	UTSW	5	112914984	missense	possibly damaging	0.77
R4392:Grk3	UTSW	5	112920136	missense	probably damaging	1.00
R4439:Grk3	UTSW	5	112946677	splice site	probably null
R4589:Grk3	UTSW	5	112941718	missense	possibly damaging	0.87
R4646:Grk3	UTSW	5	112929720	missense	probably benign	0.04
R5154:Grk3	UTSW	5	112941717	missense	probably damaging	1.00
R5462:Grk3	UTSW	5	112969208	missense	probably damaging	1.00
R5764:Grk3	UTSW	5	112966910	critical splice donor site	probably null
R5790:Grk3	UTSW	5	112966976	missense	possibly damaging	0.80
R6516:Grk3	UTSW	5	112961549	intron	probably benign
R6848:Grk3	UTSW	5	112985775	missense	probably damaging	0.98
R7857:Grk3	UTSW	5	112961561	missense	unknown
R7873:Grk3	UTSW	5	112929686	missense	probably benign	0.03
R8029:Grk3	UTSW	5	112961642	missense	probably benign
RF021:Grk3	UTSW	5	112941688	missense	probably benign	0.20
Z1176:Grk3	UTSW	5	112957314	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TGAGTGCACAGTCTGTCCTC -3'
(R):5'- CTTTCTTTGCAGCCATACATAGAAG -3'

Sequencing Primer
(F):5'- GATGTGTCTCAAGATCCTAAGATGTG -3'
(R):5'- GAAATCTGTGAAAGCCTTCGTG -3'

Posted On

2020-06-30