Incidental Mutation 'R8132:Hyal6'
ID632067
Institutional Source Beutler Lab
Gene Symbol Hyal6
Ensembl Gene ENSMUSG00000029679
Gene Namehyaluronoglucosaminidase 6
Synonyms4932701A20Rik, Hyal-ps1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R8132 (G1)
Quality Score159.009
Status Not validated
Chromosome6
Chromosomal Location24733245-24745452 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24740828 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 327 (I327L)
Ref Sequence ENSEMBL: ENSMUSP00000031690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031690]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031690
AA Change: I327L

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000031690
Gene: ENSMUSG00000029679
AA Change: I327L

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Glyco_hydro_56 30 363 4.8e-136 PFAM
EGF 365 438 6.02e0 SMART
transmembrane domain 457 479 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,965,018 A403T Het
Abhd16b G A 2: 181,493,967 A221T probably damaging Het
Arhgef1 C T 7: 24,919,749 Q472* probably null Het
Arhgef1 C T 7: 24,907,662 probably benign Het
Calr3 C T 8: 72,427,179 G298S probably damaging Het
Chrng A G 1: 87,205,996 T15A unknown Het
CK137956 T A 4: 127,951,282 K223* probably null Het
Clca3b A T 3: 144,847,174 S97T probably benign Het
Cops7b G T 1: 86,587,194 G102V probably damaging Het
Dennd1a T A 2: 37,858,060 S382C probably damaging Het
Fdps G A 3: 89,099,386 Q66* probably null Het
Gemin4 T C 11: 76,212,913 T341A probably benign Het
Gm37596 G A 3: 93,692,145 Q306* probably null Het
Grk3 A G 5: 112,961,489 S201P unknown Het
Hgf C T 5: 16,602,331 T407I probably damaging Het
Hip1r C T 5: 123,997,227 R446C probably damaging Het
Ifna15 T C 4: 88,557,683 E188G possibly damaging Het
Igip A G 18: 36,301,213 S11G probably benign Het
Igkv5-39 A G 6: 69,900,605 Y56H probably damaging Het
Jph1 G A 1: 17,016,155 T381I probably damaging Het
Lrrc55 T C 2: 85,191,915 I311V probably benign Het
Mrps35 T A 6: 147,048,163 D58E probably benign Het
Ms4a4d C A 19: 11,557,946 P203T probably benign Het
Naip1 T G 13: 100,437,375 E225D possibly damaging Het
Ncapg2 T A 12: 116,444,347 I989N possibly damaging Het
Nek3 A T 8: 22,157,020 Y166* probably null Het
Nphs1 A G 7: 30,482,053 E1169G probably benign Het
Nudt15 G A 14: 73,521,659 P123L probably benign Het
Olfr1491 G A 19: 13,705,220 C131Y probably damaging Het
Olfr160 C T 9: 37,712,073 V69M probably benign Het
Olfr204 T C 16: 59,314,544 I288V possibly damaging Het
Olfr427 T A 1: 174,100,171 S238T probably damaging Het
Olfr95 T A 17: 37,211,316 E179V probably damaging Het
Pcdha5 T C 18: 36,960,641 S68P possibly damaging Het
Plec G T 15: 76,190,573 A330E unknown Het
Rpa3 A C 6: 8,256,790 I63S probably damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Snap25 A T 2: 136,769,828 K83N probably benign Het
Sos1 T G 17: 80,408,602 Q977P probably damaging Het
Spag16 A G 1: 70,381,302 Y483C probably damaging Het
Speg A G 1: 75,422,995 E2362G probably damaging Het
Swap70 A G 7: 110,255,877 D128G probably damaging Het
Syngap1 G A 17: 26,958,180 M545I probably damaging Het
Tmem147 T C 7: 30,728,447 E110G probably damaging Het
Tmem156 T A 5: 65,075,755 I155F probably benign Het
Trim25 C A 11: 89,016,606 A597E probably damaging Het
Ttc7b T C 12: 100,446,872 Y229C probably damaging Het
Utrn T A 10: 12,682,410 Q1435L probably damaging Het
Zbtb41 T C 1: 139,423,217 S23P probably benign Het
Zeb2 T A 2: 44,989,130 I1075F probably damaging Het
Other mutations in Hyal6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01351:Hyal6 APN 6 24734179 missense probably damaging 1.00
IGL02269:Hyal6 APN 6 24740859 missense probably damaging 0.97
IGL02729:Hyal6 APN 6 24734695 missense probably damaging 1.00
IGL02793:Hyal6 APN 6 24734379 nonsense probably null
IGL02943:Hyal6 APN 6 24743439 missense probably damaging 0.99
IGL03351:Hyal6 APN 6 24743429 missense probably damaging 1.00
R0481:Hyal6 UTSW 6 24743418 missense probably damaging 1.00
R0517:Hyal6 UTSW 6 24734853 missense probably benign
R0853:Hyal6 UTSW 6 24734073 missense probably benign
R1182:Hyal6 UTSW 6 24743417 missense probably damaging 1.00
R1401:Hyal6 UTSW 6 24743435 missense probably damaging 1.00
R1780:Hyal6 UTSW 6 24734032 splice site probably benign
R1858:Hyal6 UTSW 6 24740858 missense probably benign 0.01
R2011:Hyal6 UTSW 6 24734724 missense possibly damaging 0.69
R3441:Hyal6 UTSW 6 24734593 missense probably benign
R4819:Hyal6 UTSW 6 24734966 nonsense probably null
R5357:Hyal6 UTSW 6 24734518 missense probably benign 0.05
R5648:Hyal6 UTSW 6 24734236 missense possibly damaging 0.61
R5717:Hyal6 UTSW 6 24743691 missense probably benign 0.15
R5884:Hyal6 UTSW 6 24743369 missense probably damaging 1.00
R6657:Hyal6 UTSW 6 24734758 missense possibly damaging 0.61
R6826:Hyal6 UTSW 6 24734372 missense probably damaging 1.00
R7178:Hyal6 UTSW 6 24734835 missense probably benign 0.28
R7531:Hyal6 UTSW 6 24740787 missense possibly damaging 0.46
R7630:Hyal6 UTSW 6 24734584 missense probably damaging 1.00
R7787:Hyal6 UTSW 6 24743736 missense probably damaging 0.99
R7851:Hyal6 UTSW 6 24734498 missense probably benign 0.05
R8200:Hyal6 UTSW 6 24734566 missense probably benign 0.01
R8294:Hyal6 UTSW 6 24734379 missense possibly damaging 0.53
R8300:Hyal6 UTSW 6 24734088 missense probably benign
R8509:Hyal6 UTSW 6 24734606 missense probably damaging 1.00
X0019:Hyal6 UTSW 6 24734667 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCCCAAATCACCTTTTCCAG -3'
(R):5'- TGACCCGTGTTCATCCCTACAG -3'

Sequencing Primer
(F):5'- CCAGCACTTCGATAATGGTTTC -3'
(R):5'- TAGGACAGCAGTTCTCAACCTGTG -3'
Posted On2020-06-30