Incidental Mutation 'R8132:Arhgef1'
ID632070
Institutional Source Beutler Lab
Gene Symbol Arhgef1
Ensembl Gene ENSMUSG00000040940
Gene NameRho guanine nucleotide exchange factor (GEF) 1
SynonymsLbcl2, Lsc
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.376) question?
Stock #R8132 (G1)
Quality Score176.009
Status Not validated
Chromosome7
Chromosomal Location24902912-24926594 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to T at 24907662 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047873] [ENSMUST00000098683] [ENSMUST00000117419] [ENSMUST00000117796] [ENSMUST00000151121] [ENSMUST00000205295] [ENSMUST00000206011] [ENSMUST00000206028] [ENSMUST00000206508] [ENSMUST00000206906]
Predicted Effect probably benign
Transcript: ENSMUST00000047873
SMART Domains Protein: ENSMUSP00000046469
Gene: ENSMUSG00000040940

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:RGS-like 40 230 1.3e-72 PFAM
low complexity region 380 400 N/A INTRINSIC
RhoGEF 419 603 1.87e-63 SMART
PH 647 761 4.68e-5 SMART
low complexity region 845 864 N/A INTRINSIC
coiled coil region 867 890 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098683
SMART Domains Protein: ENSMUSP00000096280
Gene: ENSMUSG00000040940

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:RGS-like 40 230 2.2e-78 PFAM
PDB:3ODW|B 238 384 2e-57 PDB
low complexity region 396 412 N/A INTRINSIC
low complexity region 439 459 N/A INTRINSIC
RhoGEF 478 662 1.87e-63 SMART
PH 706 820 4.68e-5 SMART
low complexity region 904 923 N/A INTRINSIC
coiled coil region 926 949 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117419
SMART Domains Protein: ENSMUSP00000113366
Gene: ENSMUSG00000040940

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:RGS-like 40 230 1.3e-72 PFAM
low complexity region 380 400 N/A INTRINSIC
RhoGEF 419 603 1.87e-63 SMART
PH 647 761 4.68e-5 SMART
low complexity region 845 864 N/A INTRINSIC
coiled coil region 867 890 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117796
SMART Domains Protein: ENSMUSP00000113771
Gene: ENSMUSG00000040940

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:RGS-like 40 230 7.3e-73 PFAM
low complexity region 393 409 N/A INTRINSIC
low complexity region 436 456 N/A INTRINSIC
RhoGEF 475 659 1.87e-63 SMART
PH 703 817 4.68e-5 SMART
low complexity region 901 920 N/A INTRINSIC
coiled coil region 923 946 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151121
SMART Domains Protein: ENSMUSP00000114388
Gene: ENSMUSG00000040940

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:RGS-like 40 101 5.3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205295
Predicted Effect probably benign
Transcript: ENSMUST00000206011
Predicted Effect probably benign
Transcript: ENSMUST00000206028
Predicted Effect probably benign
Transcript: ENSMUST00000206508
Predicted Effect probably benign
Transcript: ENSMUST00000206906
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form complex with G proteins and stimulate Rho-dependent signals. Multiple alternatively spliced transcript variants have been found for this gene, but the full-length nature of some variants has not been defined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in impaired humeral immunity, reduced numbers of marginal zone B (MZB) cells, decreased basal T cell proliferation, and reduced basal motility of lymphocytes but enhanced migration of MZB cells after serum activation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,965,018 A403T Het
Abhd16b G A 2: 181,493,967 A221T probably damaging Het
Calr3 C T 8: 72,427,179 G298S probably damaging Het
Chrng A G 1: 87,205,996 T15A unknown Het
CK137956 T A 4: 127,951,282 K223* probably null Het
Clca3b A T 3: 144,847,174 S97T probably benign Het
Cops7b G T 1: 86,587,194 G102V probably damaging Het
Dennd1a T A 2: 37,858,060 S382C probably damaging Het
Fdps G A 3: 89,099,386 Q66* probably null Het
Gemin4 T C 11: 76,212,913 T341A probably benign Het
Gm37596 G A 3: 93,692,145 Q306* probably null Het
Grk3 A G 5: 112,961,489 S201P unknown Het
Hgf C T 5: 16,602,331 T407I probably damaging Het
Hip1r C T 5: 123,997,227 R446C probably damaging Het
Hyal6 A T 6: 24,740,828 I327L possibly damaging Het
Ifna15 T C 4: 88,557,683 E188G possibly damaging Het
Igip A G 18: 36,301,213 S11G probably benign Het
Igkv5-39 A G 6: 69,900,605 Y56H probably damaging Het
Jph1 G A 1: 17,016,155 T381I probably damaging Het
Lrrc55 T C 2: 85,191,915 I311V probably benign Het
Mrps35 T A 6: 147,048,163 D58E probably benign Het
Ms4a4d C A 19: 11,557,946 P203T probably benign Het
Naip1 T G 13: 100,437,375 E225D possibly damaging Het
Ncapg2 T A 12: 116,444,347 I989N possibly damaging Het
Nek3 A T 8: 22,157,020 Y166* probably null Het
Nphs1 A G 7: 30,482,053 E1169G probably benign Het
Nudt15 G A 14: 73,521,659 P123L probably benign Het
Olfr1491 G A 19: 13,705,220 C131Y probably damaging Het
Olfr160 C T 9: 37,712,073 V69M probably benign Het
Olfr204 T C 16: 59,314,544 I288V possibly damaging Het
Olfr427 T A 1: 174,100,171 S238T probably damaging Het
Olfr95 T A 17: 37,211,316 E179V probably damaging Het
Pcdha5 T C 18: 36,960,641 S68P possibly damaging Het
Plec G T 15: 76,190,573 A330E unknown Het
Rpa3 A C 6: 8,256,790 I63S probably damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Snap25 A T 2: 136,769,828 K83N probably benign Het
Sos1 T G 17: 80,408,602 Q977P probably damaging Het
Spag16 A G 1: 70,381,302 Y483C probably damaging Het
Speg A G 1: 75,422,995 E2362G probably damaging Het
Swap70 A G 7: 110,255,877 D128G probably damaging Het
Syngap1 G A 17: 26,958,180 M545I probably damaging Het
Tmem147 T C 7: 30,728,447 E110G probably damaging Het
Tmem156 T A 5: 65,075,755 I155F probably benign Het
Trim25 C A 11: 89,016,606 A597E probably damaging Het
Ttc7b T C 12: 100,446,872 Y229C probably damaging Het
Utrn T A 10: 12,682,410 Q1435L probably damaging Het
Zbtb41 T C 1: 139,423,217 S23P probably benign Het
Zeb2 T A 2: 44,989,130 I1075F probably damaging Het
Other mutations in Arhgef1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Arhgef1 APN 7 24908359 missense possibly damaging 0.93
IGL00901:Arhgef1 APN 7 24912693 missense probably damaging 1.00
IGL01139:Arhgef1 APN 7 24925951 unclassified probably benign
IGL01479:Arhgef1 APN 7 24912603 missense probably benign 0.01
IGL01935:Arhgef1 APN 7 24921882 missense probably damaging 1.00
IGL01944:Arhgef1 APN 7 24925783 critical splice acceptor site probably null
IGL02032:Arhgef1 APN 7 24923371 missense probably benign 0.23
IGL02059:Arhgef1 APN 7 24912552 splice site probably benign
IGL02202:Arhgef1 APN 7 24913429 nonsense probably null
IGL02324:Arhgef1 APN 7 24923815 missense probably damaging 1.00
IGL02328:Arhgef1 APN 7 24923815 missense probably damaging 1.00
IGL03027:Arhgef1 APN 7 24923732 missense probably damaging 0.98
IGL03227:Arhgef1 APN 7 24922851 missense probably damaging 1.00
IGL03404:Arhgef1 APN 7 24916843 missense probably benign 0.07
BB009:Arhgef1 UTSW 7 24919710 missense probably damaging 1.00
BB019:Arhgef1 UTSW 7 24919710 missense probably damaging 1.00
R0082:Arhgef1 UTSW 7 24912605 nonsense probably null
R0277:Arhgef1 UTSW 7 24923799 unclassified probably benign
R0336:Arhgef1 UTSW 7 24921957 missense possibly damaging 0.77
R0494:Arhgef1 UTSW 7 24919360 intron probably benign
R0668:Arhgef1 UTSW 7 24907920 missense possibly damaging 0.63
R1520:Arhgef1 UTSW 7 24919704 missense probably damaging 1.00
R1531:Arhgef1 UTSW 7 24924998 missense probably damaging 0.99
R1656:Arhgef1 UTSW 7 24913632 missense probably damaging 1.00
R2979:Arhgef1 UTSW 7 24907751 missense unknown
R3855:Arhgef1 UTSW 7 24919272 missense probably damaging 1.00
R3856:Arhgef1 UTSW 7 24919272 missense probably damaging 1.00
R4080:Arhgef1 UTSW 7 24925846 missense probably damaging 0.96
R4081:Arhgef1 UTSW 7 24925846 missense probably damaging 0.96
R4583:Arhgef1 UTSW 7 24912571 missense probably benign 0.09
R4750:Arhgef1 UTSW 7 24918576 intron probably benign
R4914:Arhgef1 UTSW 7 24923839 missense probably damaging 1.00
R5255:Arhgef1 UTSW 7 24925022 missense probably damaging 1.00
R5275:Arhgef1 UTSW 7 24919352 critical splice donor site probably null
R5295:Arhgef1 UTSW 7 24919352 critical splice donor site probably null
R5430:Arhgef1 UTSW 7 24912307 splice site probably null
R5604:Arhgef1 UTSW 7 24912785 missense probably benign 0.09
R6150:Arhgef1 UTSW 7 24919357 splice site probably null
R6151:Arhgef1 UTSW 7 24917942 missense probably benign 0.00
R6788:Arhgef1 UTSW 7 24919780 splice site probably null
R6943:Arhgef1 UTSW 7 24923731 missense probably benign 0.01
R6988:Arhgef1 UTSW 7 24916923 missense probably benign 0.04
R7422:Arhgef1 UTSW 7 24916036 missense probably benign 0.00
R7701:Arhgef1 UTSW 7 24912578 missense probably benign 0.01
R7706:Arhgef1 UTSW 7 24916881 missense probably damaging 1.00
R7707:Arhgef1 UTSW 7 24916881 missense probably damaging 1.00
R7708:Arhgef1 UTSW 7 24916881 missense probably damaging 1.00
R7932:Arhgef1 UTSW 7 24919710 missense probably damaging 1.00
R7967:Arhgef1 UTSW 7 24916881 missense probably damaging 1.00
R7970:Arhgef1 UTSW 7 24916881 missense probably damaging 1.00
R7995:Arhgef1 UTSW 7 24919216 missense probably damaging 0.99
R8029:Arhgef1 UTSW 7 24919738 missense probably damaging 1.00
R8132:Arhgef1 UTSW 7 24919749 nonsense probably null
R8168:Arhgef1 UTSW 7 24925406 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TGGTTTTACCCACAGCCAC -3'
(R):5'- GATGATGATGGACACCAGGC -3'

Sequencing Primer
(F):5'- TTTACCCACAGCCACCCAGC -3'
(R):5'- GGGGACACATGGTTTCAATTCAC -3'
Posted On2020-06-30