Incidental Mutation 'R8132:Nphs1'
ID632072
Institutional Source Beutler Lab
Gene Symbol Nphs1
Ensembl Gene ENSMUSG00000006649
Gene Namenephrosis 1, nephrin
Synonymsnephrin
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8132 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location30458315-30487223 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30482053 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1169 (E1169G)
Ref Sequence ENSEMBL: ENSMUSP00000006825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006825] [ENSMUST00000126297]
Predicted Effect probably benign
Transcript: ENSMUST00000006825
AA Change: E1169G

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000006825
Gene: ENSMUSG00000006649
AA Change: E1169G

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
IG 52 146 1.38e-6 SMART
Pfam:C2-set_2 152 242 4.1e-20 PFAM
IG 264 351 9.86e-3 SMART
IG_like 360 452 2.73e1 SMART
IG 464 556 2.99e-2 SMART
IG_like 572 644 8.9e-1 SMART
IG 667 751 1.32e-3 SMART
IG 760 849 7.3e-6 SMART
IGc2 868 941 5.4e-9 SMART
FN3 955 1036 1.01e-11 SMART
transmembrane domain 1078 1100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126297
AA Change: E1155G

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000116500
Gene: ENSMUSG00000006649
AA Change: E1155G

DomainStartEndE-ValueType
IG 38 132 1.38e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149086
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin family of cell adhesion molecules that functions in the glomerular filtration barrier in the kidney. The gene is primarily expressed in renal tissues, and the protein is a type-1 transmembrane protein found at the slit diaphragm of glomerular podocytes. The slit diaphragm is thought to function as an ultrafilter to exclude albumin and other plasma macromolecules in the formation of urine. Mutations in this gene result in Finnish-type congenital nephrosis 1, characterized by severe proteinuria and loss of the slit diaphragm and foot processes.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe proteinuria associated with kidney defects and die soon after birth. Heterozygotes exhibit fusion of one-third of glomerular foot processes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,965,018 A403T Het
Abhd16b G A 2: 181,493,967 A221T probably damaging Het
Arhgef1 C T 7: 24,907,662 probably benign Het
Arhgef1 C T 7: 24,919,749 Q472* probably null Het
Calr3 C T 8: 72,427,179 G298S probably damaging Het
Chrng A G 1: 87,205,996 T15A unknown Het
CK137956 T A 4: 127,951,282 K223* probably null Het
Clca3b A T 3: 144,847,174 S97T probably benign Het
Cops7b G T 1: 86,587,194 G102V probably damaging Het
Dennd1a T A 2: 37,858,060 S382C probably damaging Het
Fdps G A 3: 89,099,386 Q66* probably null Het
Gemin4 T C 11: 76,212,913 T341A probably benign Het
Gm37596 G A 3: 93,692,145 Q306* probably null Het
Grk3 A G 5: 112,961,489 S201P unknown Het
Hgf C T 5: 16,602,331 T407I probably damaging Het
Hip1r C T 5: 123,997,227 R446C probably damaging Het
Hyal6 A T 6: 24,740,828 I327L possibly damaging Het
Ifna15 T C 4: 88,557,683 E188G possibly damaging Het
Igip A G 18: 36,301,213 S11G probably benign Het
Igkv5-39 A G 6: 69,900,605 Y56H probably damaging Het
Jph1 G A 1: 17,016,155 T381I probably damaging Het
Lrrc55 T C 2: 85,191,915 I311V probably benign Het
Mrps35 T A 6: 147,048,163 D58E probably benign Het
Ms4a4d C A 19: 11,557,946 P203T probably benign Het
Naip1 T G 13: 100,437,375 E225D possibly damaging Het
Ncapg2 T A 12: 116,444,347 I989N possibly damaging Het
Nek3 A T 8: 22,157,020 Y166* probably null Het
Nudt15 G A 14: 73,521,659 P123L probably benign Het
Olfr1491 G A 19: 13,705,220 C131Y probably damaging Het
Olfr160 C T 9: 37,712,073 V69M probably benign Het
Olfr204 T C 16: 59,314,544 I288V possibly damaging Het
Olfr427 T A 1: 174,100,171 S238T probably damaging Het
Olfr95 T A 17: 37,211,316 E179V probably damaging Het
Pcdha5 T C 18: 36,960,641 S68P possibly damaging Het
Plec G T 15: 76,190,573 A330E unknown Het
Rpa3 A C 6: 8,256,790 I63S probably damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Snap25 A T 2: 136,769,828 K83N probably benign Het
Sos1 T G 17: 80,408,602 Q977P probably damaging Het
Spag16 A G 1: 70,381,302 Y483C probably damaging Het
Speg A G 1: 75,422,995 E2362G probably damaging Het
Swap70 A G 7: 110,255,877 D128G probably damaging Het
Syngap1 G A 17: 26,958,180 M545I probably damaging Het
Tmem147 T C 7: 30,728,447 E110G probably damaging Het
Tmem156 T A 5: 65,075,755 I155F probably benign Het
Trim25 C A 11: 89,016,606 A597E probably damaging Het
Ttc7b T C 12: 100,446,872 Y229C probably damaging Het
Utrn T A 10: 12,682,410 Q1435L probably damaging Het
Zbtb41 T C 1: 139,423,217 S23P probably benign Het
Zeb2 T A 2: 44,989,130 I1075F probably damaging Het
Other mutations in Nphs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Nphs1 APN 7 30482551 missense possibly damaging 0.77
IGL00927:Nphs1 APN 7 30460739 unclassified probably benign
IGL00976:Nphs1 APN 7 30460685 missense possibly damaging 0.78
IGL01397:Nphs1 APN 7 30486664 missense probably benign 0.01
IGL01465:Nphs1 APN 7 30486714 makesense probably null
IGL01889:Nphs1 APN 7 30460511 missense probably damaging 1.00
IGL02383:Nphs1 APN 7 30481635 splice site probably benign
R0020:Nphs1 UTSW 7 30463208 missense probably benign 0.01
R0485:Nphs1 UTSW 7 30467515 missense probably benign
R1024:Nphs1 UTSW 7 30474277 missense probably damaging 1.00
R1115:Nphs1 UTSW 7 30481378 splice site probably benign
R1144:Nphs1 UTSW 7 30481678 splice site probably benign
R1289:Nphs1 UTSW 7 30471178 missense probably damaging 1.00
R1317:Nphs1 UTSW 7 30481831 splice site probably benign
R1617:Nphs1 UTSW 7 30482531 missense probably benign
R1756:Nphs1 UTSW 7 30461534 missense probably benign 0.00
R1937:Nphs1 UTSW 7 30474373 missense probably damaging 1.00
R2144:Nphs1 UTSW 7 30460970 missense probably benign 0.13
R2256:Nphs1 UTSW 7 30467992 missense possibly damaging 0.94
R2257:Nphs1 UTSW 7 30467992 missense possibly damaging 0.94
R2277:Nphs1 UTSW 7 30467564 nonsense probably null
R3104:Nphs1 UTSW 7 30467540 nonsense probably null
R3106:Nphs1 UTSW 7 30467540 nonsense probably null
R3151:Nphs1 UTSW 7 30460240 missense probably benign
R3765:Nphs1 UTSW 7 30471210 missense probably damaging 0.98
R4078:Nphs1 UTSW 7 30467520 nonsense probably null
R4397:Nphs1 UTSW 7 30481965 splice site probably null
R4635:Nphs1 UTSW 7 30468007 missense probably benign 0.39
R4650:Nphs1 UTSW 7 30482470 missense probably benign 0.21
R4811:Nphs1 UTSW 7 30460429 missense probably damaging 1.00
R4850:Nphs1 UTSW 7 30463232 missense possibly damaging 0.78
R5272:Nphs1 UTSW 7 30481642 missense possibly damaging 0.86
R5327:Nphs1 UTSW 7 30463825 missense probably benign 0.00
R5681:Nphs1 UTSW 7 30486625 missense probably benign 0.00
R5865:Nphs1 UTSW 7 30474385 missense probably damaging 1.00
R5975:Nphs1 UTSW 7 30466115 missense possibly damaging 0.82
R6186:Nphs1 UTSW 7 30465634 missense probably damaging 0.98
R6198:Nphs1 UTSW 7 30467915 missense probably damaging 0.97
R6353:Nphs1 UTSW 7 30474544 missense probably damaging 0.99
R7405:Nphs1 UTSW 7 30462828 missense possibly damaging 0.46
R7647:Nphs1 UTSW 7 30481965 splice site probably null
R7767:Nphs1 UTSW 7 30463308 missense probably damaging 1.00
X0028:Nphs1 UTSW 7 30467504 missense probably null 0.01
Z1177:Nphs1 UTSW 7 30470903 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAATCACTGCCATCTCCTGGG -3'
(R):5'- CAATACCTGTGAAGGCTGGAG -3'

Sequencing Primer
(F):5'- ATCTCCTGGGACCTGAGAGTCAAG -3'
(R):5'- TGTCTGCCGTGATAAGAGCAACTC -3'
Posted On2020-06-30