Incidental Mutation 'R8132:Tmem147'
ID632073
Institutional Source Beutler Lab
Gene Symbol Tmem147
Ensembl Gene ENSMUSG00000006315
Gene Nametransmembrane protein 147
Synonyms5033425B17Rik, 2010004E11Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.911) question?
Stock #R8132 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location30727701-30729540 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30728447 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 110 (E110G)
Ref Sequence ENSEMBL: ENSMUSP00000006478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005692] [ENSMUST00000006478] [ENSMUST00000074758] [ENSMUST00000170371] [ENSMUST00000182067] [ENSMUST00000182634] [ENSMUST00000207263] [ENSMUST00000207296] [ENSMUST00000207779] [ENSMUST00000208169] [ENSMUST00000209065]
Predicted Effect probably benign
Transcript: ENSMUST00000005692
SMART Domains Protein: ENSMUSP00000005692
Gene: ENSMUSG00000005553

DomainStartEndE-ValueType
Pfam:H-K_ATPase_N 2 42 5.4e-23 PFAM
Cation_ATPase_N 52 126 2.26e-18 SMART
Pfam:E1-E2_ATPase 144 375 1.1e-57 PFAM
Pfam:Hydrolase 380 739 5.3e-16 PFAM
Pfam:HAD 383 736 1.9e-18 PFAM
Pfam:Cation_ATPase 436 531 1.6e-24 PFAM
Pfam:Cation_ATPase_C 809 1019 4.8e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000006478
AA Change: E110G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000006478
Gene: ENSMUSG00000006315
AA Change: E110G

DomainStartEndE-ValueType
Pfam:DUF2053 2 158 3.1e-69 PFAM
transmembrane domain 168 190 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000074758
SMART Domains Protein: ENSMUSP00000074317
Gene: ENSMUSG00000061099

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
Gp_dh_N 106 254 6.13e-79 SMART
Pfam:Gp_dh_C 259 416 2.3e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170371
SMART Domains Protein: ENSMUSP00000131964
Gene: ENSMUSG00000005553

DomainStartEndE-ValueType
Pfam:H-K_ATPase_N 2 42 4.9e-28 PFAM
Cation_ATPase_N 52 126 2.26e-18 SMART
Pfam:E1-E2_ATPase 145 376 1e-62 PFAM
Pfam:Hydrolase 380 730 9.3e-25 PFAM
Pfam:HAD 383 727 2.1e-15 PFAM
Pfam:Hydrolase_like2 436 531 4e-25 PFAM
Pfam:Cation_ATPase_C 800 1010 1.5e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182067
SMART Domains Protein: ENSMUSP00000138697
Gene: ENSMUSG00000061099

DomainStartEndE-ValueType
PDB:2VYV|D 1 44 3e-15 PDB
Blast:Gp_dh_N 4 33 9e-7 BLAST
SCOP:d1cf2o2 9 45 3e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182634
SMART Domains Protein: ENSMUSP00000138634
Gene: ENSMUSG00000061099

DomainStartEndE-ValueType
low complexity region 21 48 N/A INTRINSIC
Gp_dh_N 108 256 6.13e-79 SMART
Pfam:Gp_dh_C 261 418 4.4e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207263
Predicted Effect probably damaging
Transcript: ENSMUST00000207296
AA Change: E110G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000207779
Predicted Effect probably benign
Transcript: ENSMUST00000208169
Predicted Effect probably damaging
Transcript: ENSMUST00000209065
AA Change: E61G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,965,018 A403T Het
Abhd16b G A 2: 181,493,967 A221T probably damaging Het
Arhgef1 C T 7: 24,919,749 Q472* probably null Het
Arhgef1 C T 7: 24,907,662 probably benign Het
Calr3 C T 8: 72,427,179 G298S probably damaging Het
Chrng A G 1: 87,205,996 T15A unknown Het
CK137956 T A 4: 127,951,282 K223* probably null Het
Clca3b A T 3: 144,847,174 S97T probably benign Het
Cops7b G T 1: 86,587,194 G102V probably damaging Het
Dennd1a T A 2: 37,858,060 S382C probably damaging Het
Fdps G A 3: 89,099,386 Q66* probably null Het
Gemin4 T C 11: 76,212,913 T341A probably benign Het
Gm37596 G A 3: 93,692,145 Q306* probably null Het
Grk3 A G 5: 112,961,489 S201P unknown Het
Hgf C T 5: 16,602,331 T407I probably damaging Het
Hip1r C T 5: 123,997,227 R446C probably damaging Het
Hyal6 A T 6: 24,740,828 I327L possibly damaging Het
Ifna15 T C 4: 88,557,683 E188G possibly damaging Het
Igip A G 18: 36,301,213 S11G probably benign Het
Igkv5-39 A G 6: 69,900,605 Y56H probably damaging Het
Jph1 G A 1: 17,016,155 T381I probably damaging Het
Lrrc55 T C 2: 85,191,915 I311V probably benign Het
Mrps35 T A 6: 147,048,163 D58E probably benign Het
Ms4a4d C A 19: 11,557,946 P203T probably benign Het
Naip1 T G 13: 100,437,375 E225D possibly damaging Het
Ncapg2 T A 12: 116,444,347 I989N possibly damaging Het
Nek3 A T 8: 22,157,020 Y166* probably null Het
Nphs1 A G 7: 30,482,053 E1169G probably benign Het
Nudt15 G A 14: 73,521,659 P123L probably benign Het
Olfr1491 G A 19: 13,705,220 C131Y probably damaging Het
Olfr160 C T 9: 37,712,073 V69M probably benign Het
Olfr204 T C 16: 59,314,544 I288V possibly damaging Het
Olfr427 T A 1: 174,100,171 S238T probably damaging Het
Olfr95 T A 17: 37,211,316 E179V probably damaging Het
Pcdha5 T C 18: 36,960,641 S68P possibly damaging Het
Plec G T 15: 76,190,573 A330E unknown Het
Rpa3 A C 6: 8,256,790 I63S probably damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Snap25 A T 2: 136,769,828 K83N probably benign Het
Sos1 T G 17: 80,408,602 Q977P probably damaging Het
Spag16 A G 1: 70,381,302 Y483C probably damaging Het
Speg A G 1: 75,422,995 E2362G probably damaging Het
Swap70 A G 7: 110,255,877 D128G probably damaging Het
Syngap1 G A 17: 26,958,180 M545I probably damaging Het
Tmem156 T A 5: 65,075,755 I155F probably benign Het
Trim25 C A 11: 89,016,606 A597E probably damaging Het
Ttc7b T C 12: 100,446,872 Y229C probably damaging Het
Utrn T A 10: 12,682,410 Q1435L probably damaging Het
Zbtb41 T C 1: 139,423,217 S23P probably benign Het
Zeb2 T A 2: 44,989,130 I1075F probably damaging Het
Other mutations in Tmem147
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00574:Tmem147 APN 7 30728433 nonsense probably null
IGL02491:Tmem147 APN 7 30728201 splice site probably benign
IGL02971:Tmem147 APN 7 30729422 unclassified probably benign
R0070:Tmem147 UTSW 7 30728101 missense probably damaging 1.00
R0609:Tmem147 UTSW 7 30728102 missense probably benign 0.03
R1167:Tmem147 UTSW 7 30727796 missense probably benign 0.33
R1254:Tmem147 UTSW 7 30729370 nonsense probably null
R5983:Tmem147 UTSW 7 30728059 missense probably damaging 1.00
R6072:Tmem147 UTSW 7 30728020 missense possibly damaging 0.56
R7636:Tmem147 UTSW 7 30728301 splice site probably null
R7705:Tmem147 UTSW 7 30728291 critical splice acceptor site probably null
R8042:Tmem147 UTSW 7 30728553 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GATGTTGGAGTCAATGCTCATC -3'
(R):5'- AAGAGTGCAGGAGTCGGTTC -3'

Sequencing Primer
(F):5'- GTCAAATTCAATGCCTCGGG -3'
(R):5'- AGGAGTCGGTTCACCTGGTC -3'
Posted On2020-06-30