Incidental Mutation 'R8132:Nek3'
ID632076
Institutional Source Beutler Lab
Gene Symbol Nek3
Ensembl Gene ENSMUSG00000031478
Gene NameNIMA (never in mitosis gene a)-related expressed kinase 3
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8132 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location22128283-22166435 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 22157020 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 166 (Y166*)
Ref Sequence ENSEMBL: ENSMUSP00000033865 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033865] [ENSMUST00000110730] [ENSMUST00000178324]
Predicted Effect probably null
Transcript: ENSMUST00000033865
AA Change: Y166*
SMART Domains Protein: ENSMUSP00000033865
Gene: ENSMUSG00000031478
AA Change: Y166*

DomainStartEndE-ValueType
S_TKc 4 259 1.11e-89 SMART
Blast:S_TKc 267 444 8e-49 BLAST
low complexity region 471 485 N/A INTRINSIC
low complexity region 495 506 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110730
AA Change: Y166*
SMART Domains Protein: ENSMUSP00000106358
Gene: ENSMUSG00000031478
AA Change: Y166*

DomainStartEndE-ValueType
S_TKc 4 259 1.11e-89 SMART
Blast:S_TKc 267 446 1e-48 BLAST
low complexity region 473 487 N/A INTRINSIC
low complexity region 497 508 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000178324
AA Change: Y166*
SMART Domains Protein: ENSMUSP00000136876
Gene: ENSMUSG00000031478
AA Change: Y166*

DomainStartEndE-ValueType
S_TKc 4 259 1.11e-89 SMART
Blast:S_TKc 267 446 1e-48 BLAST
low complexity region 473 487 N/A INTRINSIC
low complexity region 497 508 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NimA (never in mitosis A) family of serine/threonine protein kinases. The encoded protein differs from other NimA family members in that it is not cell cycle regulated and is found primarily in the cytoplasm. The kinase is activated by prolactin stimulation, leading to phosphorylation of VAV2 guanine nucleotide exchange factor, paxillin, and activation of the RAC1 GTPase. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,965,018 A403T Het
Abhd16b G A 2: 181,493,967 A221T probably damaging Het
Arhgef1 C T 7: 24,907,662 probably benign Het
Arhgef1 C T 7: 24,919,749 Q472* probably null Het
Calr3 C T 8: 72,427,179 G298S probably damaging Het
Chrng A G 1: 87,205,996 T15A unknown Het
CK137956 T A 4: 127,951,282 K223* probably null Het
Clca3b A T 3: 144,847,174 S97T probably benign Het
Cops7b G T 1: 86,587,194 G102V probably damaging Het
Dennd1a T A 2: 37,858,060 S382C probably damaging Het
Fdps G A 3: 89,099,386 Q66* probably null Het
Gemin4 T C 11: 76,212,913 T341A probably benign Het
Gm37596 G A 3: 93,692,145 Q306* probably null Het
Grk3 A G 5: 112,961,489 S201P unknown Het
Hgf C T 5: 16,602,331 T407I probably damaging Het
Hip1r C T 5: 123,997,227 R446C probably damaging Het
Hyal6 A T 6: 24,740,828 I327L possibly damaging Het
Ifna15 T C 4: 88,557,683 E188G possibly damaging Het
Igip A G 18: 36,301,213 S11G probably benign Het
Igkv5-39 A G 6: 69,900,605 Y56H probably damaging Het
Jph1 G A 1: 17,016,155 T381I probably damaging Het
Lrrc55 T C 2: 85,191,915 I311V probably benign Het
Mrps35 T A 6: 147,048,163 D58E probably benign Het
Ms4a4d C A 19: 11,557,946 P203T probably benign Het
Naip1 T G 13: 100,437,375 E225D possibly damaging Het
Ncapg2 T A 12: 116,444,347 I989N possibly damaging Het
Nphs1 A G 7: 30,482,053 E1169G probably benign Het
Nudt15 G A 14: 73,521,659 P123L probably benign Het
Olfr1491 G A 19: 13,705,220 C131Y probably damaging Het
Olfr160 C T 9: 37,712,073 V69M probably benign Het
Olfr204 T C 16: 59,314,544 I288V possibly damaging Het
Olfr427 T A 1: 174,100,171 S238T probably damaging Het
Olfr95 T A 17: 37,211,316 E179V probably damaging Het
Pcdha5 T C 18: 36,960,641 S68P possibly damaging Het
Plec G T 15: 76,190,573 A330E unknown Het
Rpa3 A C 6: 8,256,790 I63S probably damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Snap25 A T 2: 136,769,828 K83N probably benign Het
Sos1 T G 17: 80,408,602 Q977P probably damaging Het
Spag16 A G 1: 70,381,302 Y483C probably damaging Het
Speg A G 1: 75,422,995 E2362G probably damaging Het
Swap70 A G 7: 110,255,877 D128G probably damaging Het
Syngap1 G A 17: 26,958,180 M545I probably damaging Het
Tmem147 T C 7: 30,728,447 E110G probably damaging Het
Tmem156 T A 5: 65,075,755 I155F probably benign Het
Trim25 C A 11: 89,016,606 A597E probably damaging Het
Ttc7b T C 12: 100,446,872 Y229C probably damaging Het
Utrn T A 10: 12,682,410 Q1435L probably damaging Het
Zbtb41 T C 1: 139,423,217 S23P probably benign Het
Zeb2 T A 2: 44,989,130 I1075F probably damaging Het
Other mutations in Nek3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Nek3 APN 8 22158706 missense probably damaging 1.00
IGL01561:Nek3 APN 8 22129456 missense probably damaging 0.97
IGL02799:Nek3 APN 8 22158719 splice site probably benign
IGL02826:Nek3 APN 8 22160368 critical splice donor site probably null
R0001:Nek3 UTSW 8 22158612 splice site probably benign
R0390:Nek3 UTSW 8 22128729 unclassified probably benign
R1367:Nek3 UTSW 8 22160361 splice site probably benign
R1565:Nek3 UTSW 8 22132201 critical splice acceptor site probably null
R1758:Nek3 UTSW 8 22160262 missense probably damaging 1.00
R1924:Nek3 UTSW 8 22157031 missense probably damaging 1.00
R3905:Nek3 UTSW 8 22133091 missense probably benign 0.01
R4078:Nek3 UTSW 8 22132137 missense probably damaging 1.00
R4089:Nek3 UTSW 8 22149913 missense probably damaging 1.00
R4621:Nek3 UTSW 8 22157039 missense probably damaging 1.00
R5207:Nek3 UTSW 8 22132227 intron probably benign
R5432:Nek3 UTSW 8 22148732 splice site probably null
R5790:Nek3 UTSW 8 22131297 missense probably damaging 1.00
R5790:Nek3 UTSW 8 22131298 missense probably damaging 1.00
R6856:Nek3 UTSW 8 22129447 missense probably damaging 1.00
R8021:Nek3 UTSW 8 22157190 missense probably damaging 1.00
R8056:Nek3 UTSW 8 22129343 critical splice donor site probably null
R8129:Nek3 UTSW 8 22149892 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGAAGCCAGGTAGACCTCCTTC -3'
(R):5'- GTCTTCCTCACCCACAATGG -3'

Sequencing Primer
(F):5'- GGTAGACCTCCTTCGACAAG -3'
(R):5'- TCACCCACAATGGAAAAGTGAAATTG -3'
Posted On2020-06-30