Mutagenetix > Incidental Mutation

Incidental Mutation 'R8132:Gemin4'

632081

Institutional Source

Beutler Lab

Gene Symbol

Gemin4

Ensembl Gene

ENSMUSG00000049396

Gene Name

gem nuclear organelle associated protein 4

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.966) question?

Stock #

R8132 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

76210571-76217664 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 76212913 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 341 (T341A)

Ref Sequence

ENSEMBL: ENSMUSP00000099558 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040806] [ENSMUST00000094014] [ENSMUST00000102500] [ENSMUST00000129853] [ENSMUST00000169560] [ENSMUST00000169701]

AlphaFold

Q6P6L6

Predicted Effect

probably benign
Transcript: ENSMUST00000040806

SMART Domains

Protein: ENSMUSP00000039763
Gene: ENSMUSG00000038057

Domain	Start	End	E-Value	Type
Pfam:ACBP	3	83	7.4e-26	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000094014

SMART Domains

Protein: ENSMUSP00000091553
Gene: ENSMUSG00000069808

Domain	Start	End	E-Value	Type
transmembrane domain	4	26	N/A	INTRINSIC
TLC	33	249	7.47e-34	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000102500
AA Change: T341A

PolyPhen 2 Score 0.253 (Sensitivity: 0.91; Specificity: 0.88)

Predicted Effect

probably benign
Transcript: ENSMUST00000129853

SMART Domains

Protein: ENSMUSP00000114936
Gene: ENSMUSG00000069808

Domain	Start	End	E-Value	Type
TLC	1	166	6.2e-8	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000169560

SMART Domains

Protein: ENSMUSP00000131151
Gene: ENSMUSG00000069808

Domain	Start	End	E-Value	Type
transmembrane domain	4	26	N/A	INTRINSIC
TLC	33	217	4.92e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000169701

SMART Domains

Protein: ENSMUSP00000131174
Gene: ENSMUSG00000017286

Domain	Start	End	E-Value	Type
Pfam:Glyoxalase_2	143	256	2.7e-8	PFAM

Coding Region Coverage

1x: 99.8%
3x: 99.6%
10x: 98.6%
20x: 94.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is part of a large complex localized to the cytoplasm, nucleoli, and to discrete nuclear bodies called Gemini bodies (gems). The complex functions in spliceosomal snRNP assembly in the cytoplasm, and regenerates spliceosomes required for pre-mRNA splicing in the nucleus. The encoded protein directly interacts with a DEAD box protein and several spliceosome core proteins. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele die before E5.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb10	C	T	8: 123,965,018	A403T		Het
Abhd16b	G	A	2: 181,493,967	A221T	probably damaging	Het
Arhgef1	C	T	7: 24,907,662		probably benign	Het
Arhgef1	C	T	7: 24,919,749	Q472*	probably null	Het
Calr3	C	T	8: 72,427,179	G298S	probably damaging	Het
Chrng	A	G	1: 87,205,996	T15A	unknown	Het
CK137956	T	A	4: 127,951,282	K223*	probably null	Het
Clca3b	A	T	3: 144,847,174	S97T	probably benign	Het
Cops7b	G	T	1: 86,587,194	G102V	probably damaging	Het
Dennd1a	T	A	2: 37,858,060	S382C	probably damaging	Het
Fdps	G	A	3: 89,099,386	Q66*	probably null	Het
Gm37596	G	A	3: 93,692,145	Q306*	probably null	Het
Grk3	A	G	5: 112,961,489	S201P	unknown	Het
Hgf	C	T	5: 16,602,331	T407I	probably damaging	Het
Hip1r	C	T	5: 123,997,227	R446C	probably damaging	Het
Hyal6	A	T	6: 24,740,828	I327L	possibly damaging	Het
Ifna15	T	C	4: 88,557,683	E188G	possibly damaging	Het
Igip	A	G	18: 36,301,213	S11G	probably benign	Het
Igkv5-39	A	G	6: 69,900,605	Y56H	probably damaging	Het
Jph1	G	A	1: 17,016,155	T381I	probably damaging	Het
Lrrc55	T	C	2: 85,191,915	I311V	probably benign	Het
Mrps35	T	A	6: 147,048,163	D58E	probably benign	Het
Ms4a4d	C	A	19: 11,557,946	P203T	probably benign	Het
Naip1	T	G	13: 100,437,375	E225D	possibly damaging	Het
Ncapg2	T	A	12: 116,444,347	I989N	possibly damaging	Het
Nek3	A	T	8: 22,157,020	Y166*	probably null	Het
Nphs1	A	G	7: 30,482,053	E1169G	probably benign	Het
Nudt15	G	A	14: 73,521,659	P123L	probably benign	Het
Olfr1491	G	A	19: 13,705,220	C131Y	probably damaging	Het
Olfr160	C	T	9: 37,712,073	V69M	probably benign	Het
Olfr204	T	C	16: 59,314,544	I288V	possibly damaging	Het
Olfr427	T	A	1: 174,100,171	S238T	probably damaging	Het
Olfr95	T	A	17: 37,211,316	E179V	probably damaging	Het
Pcdha5	T	C	18: 36,960,641	S68P	possibly damaging	Het
Plec	G	T	15: 76,190,573	A330E	unknown	Het
Rpa3	A	C	6: 8,256,790	I63S	probably damaging	Het
Rsf1	CG	CGACGGCGGGG	7: 97,579,908		probably benign	Het
Snap25	A	T	2: 136,769,828	K83N	probably benign	Het
Sos1	T	G	17: 80,408,602	Q977P	probably damaging	Het
Spag16	A	G	1: 70,381,302	Y483C	probably damaging	Het
Speg	A	G	1: 75,422,995	E2362G	probably damaging	Het
Swap70	A	G	7: 110,255,877	D128G	probably damaging	Het
Syngap1	G	A	17: 26,958,180	M545I	probably damaging	Het
Tmem147	T	C	7: 30,728,447	E110G	probably damaging	Het
Tmem156	T	A	5: 65,075,755	I155F	probably benign	Het
Trim25	C	A	11: 89,016,606	A597E	probably damaging	Het
Ttc7b	T	C	12: 100,446,872	Y229C	probably damaging	Het
Utrn	T	A	10: 12,682,410	Q1435L	probably damaging	Het
Zbtb41	T	C	1: 139,423,217	S23P	probably benign	Het
Zeb2	T	A	2: 44,989,130	I1075F	probably damaging	Het

Other mutations in Gemin4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01412:Gemin4	APN	11	76213485	missense	probably benign	0.16
IGL01654:Gemin4	APN	11	76213398	missense	probably damaging	1.00
IGL01656:Gemin4	APN	11	76213810	missense	probably damaging	1.00
IGL02890:Gemin4	APN	11	76211264	missense	probably damaging	1.00
IGL02967:Gemin4	APN	11	76212241	missense	probably damaging	1.00
R0359:Gemin4	UTSW	11	76212162	missense	probably benign	0.02
R0413:Gemin4	UTSW	11	76211322	missense	probably benign	0.00
R1538:Gemin4	UTSW	11	76211161	missense	probably benign	0.00
R1632:Gemin4	UTSW	11	76210989	missense	probably benign	0.26
R1762:Gemin4	UTSW	11	76211050	missense	probably damaging	1.00
R1783:Gemin4	UTSW	11	76211050	missense	probably damaging	1.00
R1784:Gemin4	UTSW	11	76211050	missense	probably damaging	1.00
R1785:Gemin4	UTSW	11	76211050	missense	probably damaging	1.00
R1786:Gemin4	UTSW	11	76211050	missense	probably damaging	1.00
R1835:Gemin4	UTSW	11	76213296	missense	possibly damaging	0.62
R2007:Gemin4	UTSW	11	76212618	missense	possibly damaging	0.78
R2117:Gemin4	UTSW	11	76211001	missense	possibly damaging	0.59
R2131:Gemin4	UTSW	11	76211050	missense	probably damaging	1.00
R2133:Gemin4	UTSW	11	76211050	missense	probably damaging	1.00
R2140:Gemin4	UTSW	11	76211050	missense	probably damaging	1.00
R2141:Gemin4	UTSW	11	76211050	missense	probably damaging	1.00
R2142:Gemin4	UTSW	11	76211050	missense	probably damaging	1.00
R3937:Gemin4	UTSW	11	76212888	missense	probably damaging	1.00
R4112:Gemin4	UTSW	11	76212819	missense	probably damaging	0.99
R4444:Gemin4	UTSW	11	76212091	missense	probably benign	0.00
R5502:Gemin4	UTSW	11	76213401	nonsense	probably null
R5702:Gemin4	UTSW	11	76210837	missense	probably benign	0.01
R5744:Gemin4	UTSW	11	76212165	missense	probably damaging	1.00
R6044:Gemin4	UTSW	11	76212934	missense	probably benign
R6924:Gemin4	UTSW	11	76212336	missense	probably damaging	1.00
R6931:Gemin4	UTSW	11	76210956	missense	probably damaging	0.99
R7278:Gemin4	UTSW	11	76212106	missense	probably damaging	0.98
R7286:Gemin4	UTSW	11	76212753	missense	probably damaging	0.96
R7288:Gemin4	UTSW	11	76213380	missense	possibly damaging	0.60
R7358:Gemin4	UTSW	11	76213452	nonsense	probably null
R7572:Gemin4	UTSW	11	76213582	missense	probably damaging	1.00
R8345:Gemin4	UTSW	11	76210779	missense	probably damaging	1.00
R8695:Gemin4	UTSW	11	76211830	missense	probably damaging	1.00
R8902:Gemin4	UTSW	11	76212022	nonsense	probably null
R9233:Gemin4	UTSW	11	76213116	missense	possibly damaging	0.92
R9495:Gemin4	UTSW	11	76210923	missense	probably damaging	1.00
Z1176:Gemin4	UTSW	11	76217579	unclassified	probably benign

Predicted Primers

PCR Primer
(F):5'- TGATGTCCTCAAGGCCCTTG -3'
(R):5'- AGCTACAGTGATCTCTGTGTG -3'

Sequencing Primer
(F):5'- AAGGCCCTTGTCATTCAGC -3'
(R):5'- ATCTCTGTGTGGAACTCGGACAC -3'

Posted On

2020-06-30