Incidental Mutation 'R8132:Gemin4'
ID 632081
Institutional Source Beutler Lab
Gene Symbol Gemin4
Ensembl Gene ENSMUSG00000049396
Gene Name gem nuclear organelle associated protein 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock # R8132 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 76210571-76217664 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 76212913 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 341 (T341A)
Ref Sequence ENSEMBL: ENSMUSP00000099558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040806] [ENSMUST00000094014] [ENSMUST00000102500] [ENSMUST00000129853] [ENSMUST00000169560] [ENSMUST00000169701]
AlphaFold Q6P6L6
Predicted Effect probably benign
Transcript: ENSMUST00000040806
SMART Domains Protein: ENSMUSP00000039763
Gene: ENSMUSG00000038057

DomainStartEndE-ValueType
Pfam:ACBP 3 83 7.4e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094014
SMART Domains Protein: ENSMUSP00000091553
Gene: ENSMUSG00000069808

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
TLC 33 249 7.47e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102500
AA Change: T341A

PolyPhen 2 Score 0.253 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000129853
SMART Domains Protein: ENSMUSP00000114936
Gene: ENSMUSG00000069808

DomainStartEndE-ValueType
TLC 1 166 6.2e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169560
SMART Domains Protein: ENSMUSP00000131151
Gene: ENSMUSG00000069808

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
TLC 33 217 4.92e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169701
SMART Domains Protein: ENSMUSP00000131174
Gene: ENSMUSG00000017286

DomainStartEndE-ValueType
Pfam:Glyoxalase_2 143 256 2.7e-8 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is part of a large complex localized to the cytoplasm, nucleoli, and to discrete nuclear bodies called Gemini bodies (gems). The complex functions in spliceosomal snRNP assembly in the cytoplasm, and regenerates spliceosomes required for pre-mRNA splicing in the nucleus. The encoded protein directly interacts with a DEAD box protein and several spliceosome core proteins. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele die before E5.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,965,018 A403T Het
Abhd16b G A 2: 181,493,967 A221T probably damaging Het
Arhgef1 C T 7: 24,907,662 probably benign Het
Arhgef1 C T 7: 24,919,749 Q472* probably null Het
Calr3 C T 8: 72,427,179 G298S probably damaging Het
Chrng A G 1: 87,205,996 T15A unknown Het
CK137956 T A 4: 127,951,282 K223* probably null Het
Clca3b A T 3: 144,847,174 S97T probably benign Het
Cops7b G T 1: 86,587,194 G102V probably damaging Het
Dennd1a T A 2: 37,858,060 S382C probably damaging Het
Fdps G A 3: 89,099,386 Q66* probably null Het
Gm37596 G A 3: 93,692,145 Q306* probably null Het
Grk3 A G 5: 112,961,489 S201P unknown Het
Hgf C T 5: 16,602,331 T407I probably damaging Het
Hip1r C T 5: 123,997,227 R446C probably damaging Het
Hyal6 A T 6: 24,740,828 I327L possibly damaging Het
Ifna15 T C 4: 88,557,683 E188G possibly damaging Het
Igip A G 18: 36,301,213 S11G probably benign Het
Igkv5-39 A G 6: 69,900,605 Y56H probably damaging Het
Jph1 G A 1: 17,016,155 T381I probably damaging Het
Lrrc55 T C 2: 85,191,915 I311V probably benign Het
Mrps35 T A 6: 147,048,163 D58E probably benign Het
Ms4a4d C A 19: 11,557,946 P203T probably benign Het
Naip1 T G 13: 100,437,375 E225D possibly damaging Het
Ncapg2 T A 12: 116,444,347 I989N possibly damaging Het
Nek3 A T 8: 22,157,020 Y166* probably null Het
Nphs1 A G 7: 30,482,053 E1169G probably benign Het
Nudt15 G A 14: 73,521,659 P123L probably benign Het
Olfr1491 G A 19: 13,705,220 C131Y probably damaging Het
Olfr160 C T 9: 37,712,073 V69M probably benign Het
Olfr204 T C 16: 59,314,544 I288V possibly damaging Het
Olfr427 T A 1: 174,100,171 S238T probably damaging Het
Olfr95 T A 17: 37,211,316 E179V probably damaging Het
Pcdha5 T C 18: 36,960,641 S68P possibly damaging Het
Plec G T 15: 76,190,573 A330E unknown Het
Rpa3 A C 6: 8,256,790 I63S probably damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Snap25 A T 2: 136,769,828 K83N probably benign Het
Sos1 T G 17: 80,408,602 Q977P probably damaging Het
Spag16 A G 1: 70,381,302 Y483C probably damaging Het
Speg A G 1: 75,422,995 E2362G probably damaging Het
Swap70 A G 7: 110,255,877 D128G probably damaging Het
Syngap1 G A 17: 26,958,180 M545I probably damaging Het
Tmem147 T C 7: 30,728,447 E110G probably damaging Het
Tmem156 T A 5: 65,075,755 I155F probably benign Het
Trim25 C A 11: 89,016,606 A597E probably damaging Het
Ttc7b T C 12: 100,446,872 Y229C probably damaging Het
Utrn T A 10: 12,682,410 Q1435L probably damaging Het
Zbtb41 T C 1: 139,423,217 S23P probably benign Het
Zeb2 T A 2: 44,989,130 I1075F probably damaging Het
Other mutations in Gemin4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Gemin4 APN 11 76213485 missense probably benign 0.16
IGL01654:Gemin4 APN 11 76213398 missense probably damaging 1.00
IGL01656:Gemin4 APN 11 76213810 missense probably damaging 1.00
IGL02890:Gemin4 APN 11 76211264 missense probably damaging 1.00
IGL02967:Gemin4 APN 11 76212241 missense probably damaging 1.00
R0359:Gemin4 UTSW 11 76212162 missense probably benign 0.02
R0413:Gemin4 UTSW 11 76211322 missense probably benign 0.00
R1538:Gemin4 UTSW 11 76211161 missense probably benign 0.00
R1632:Gemin4 UTSW 11 76210989 missense probably benign 0.26
R1762:Gemin4 UTSW 11 76211050 missense probably damaging 1.00
R1783:Gemin4 UTSW 11 76211050 missense probably damaging 1.00
R1784:Gemin4 UTSW 11 76211050 missense probably damaging 1.00
R1785:Gemin4 UTSW 11 76211050 missense probably damaging 1.00
R1786:Gemin4 UTSW 11 76211050 missense probably damaging 1.00
R1835:Gemin4 UTSW 11 76213296 missense possibly damaging 0.62
R2007:Gemin4 UTSW 11 76212618 missense possibly damaging 0.78
R2117:Gemin4 UTSW 11 76211001 missense possibly damaging 0.59
R2131:Gemin4 UTSW 11 76211050 missense probably damaging 1.00
R2133:Gemin4 UTSW 11 76211050 missense probably damaging 1.00
R2140:Gemin4 UTSW 11 76211050 missense probably damaging 1.00
R2141:Gemin4 UTSW 11 76211050 missense probably damaging 1.00
R2142:Gemin4 UTSW 11 76211050 missense probably damaging 1.00
R3937:Gemin4 UTSW 11 76212888 missense probably damaging 1.00
R4112:Gemin4 UTSW 11 76212819 missense probably damaging 0.99
R4444:Gemin4 UTSW 11 76212091 missense probably benign 0.00
R5502:Gemin4 UTSW 11 76213401 nonsense probably null
R5702:Gemin4 UTSW 11 76210837 missense probably benign 0.01
R5744:Gemin4 UTSW 11 76212165 missense probably damaging 1.00
R6044:Gemin4 UTSW 11 76212934 missense probably benign
R6924:Gemin4 UTSW 11 76212336 missense probably damaging 1.00
R6931:Gemin4 UTSW 11 76210956 missense probably damaging 0.99
R7278:Gemin4 UTSW 11 76212106 missense probably damaging 0.98
R7286:Gemin4 UTSW 11 76212753 missense probably damaging 0.96
R7288:Gemin4 UTSW 11 76213380 missense possibly damaging 0.60
R7358:Gemin4 UTSW 11 76213452 nonsense probably null
R7572:Gemin4 UTSW 11 76213582 missense probably damaging 1.00
R8345:Gemin4 UTSW 11 76210779 missense probably damaging 1.00
R8695:Gemin4 UTSW 11 76211830 missense probably damaging 1.00
R8902:Gemin4 UTSW 11 76212022 nonsense probably null
R9233:Gemin4 UTSW 11 76213116 missense possibly damaging 0.92
R9495:Gemin4 UTSW 11 76210923 missense probably damaging 1.00
Z1176:Gemin4 UTSW 11 76217579 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGATGTCCTCAAGGCCCTTG -3'
(R):5'- AGCTACAGTGATCTCTGTGTG -3'

Sequencing Primer
(F):5'- AAGGCCCTTGTCATTCAGC -3'
(R):5'- ATCTCTGTGTGGAACTCGGACAC -3'
Posted On 2020-06-30