Incidental Mutation 'R8132:Trim25'
ID632082
Institutional Source Beutler Lab
Gene Symbol Trim25
Ensembl Gene ENSMUSG00000000275
Gene Nametripartite motif-containing 25
Synonymsestrogen-responsive finger protein, Zfp147
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8132 (G1)
Quality Score133.008
Status Not validated
Chromosome11
Chromosomal Location88999376-89020293 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 89016606 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 597 (A597E)
Ref Sequence ENSEMBL: ENSMUSP00000103528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000284] [ENSMUST00000100627] [ENSMUST00000107896]
PDB Structure
PRY-SPRY domain of Trim25 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000000284
AA Change: A589E

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000000284
Gene: ENSMUSG00000000275
AA Change: A589E

DomainStartEndE-ValueType
RING 13 53 8.04e-9 SMART
Blast:SPEC 189 288 5e-34 BLAST
PDB:4LTB|B 189 380 7e-69 PDB
PRY 453 505 3.44e-17 SMART
SPRY 506 626 9.62e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100627
SMART Domains Protein: ENSMUSP00000098192
Gene: ENSMUSG00000000275

DomainStartEndE-ValueType
RING 13 53 8.04e-9 SMART
Blast:BBOX 151 186 3e-8 BLAST
Blast:SPEC 189 288 2e-37 BLAST
PDB:4LTB|B 189 380 2e-71 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000107896
AA Change: A597E

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103528
Gene: ENSMUSG00000000275
AA Change: A597E

DomainStartEndE-ValueType
RING 13 53 8.04e-9 SMART
Blast:SPEC 189 288 3e-34 BLAST
PDB:4LTB|B 189 380 8e-69 PDB
low complexity region 382 393 N/A INTRINSIC
PRY 461 513 3.44e-17 SMART
SPRY 514 634 9.62e-31 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to the cytoplasm. The presence of potential DNA-binding and dimerization-transactivation domains suggests that this protein may act as a transcription factor, similar to several other members of the TRIM family. Expression of the gene is upregulated in response to estrogen, and it is thought to mediate estrogen actions in breast cancer as a primary response gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Engineered mutations result in a compromised response to estrogen resulting in functional but small uteri. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,965,018 A403T Het
Abhd16b G A 2: 181,493,967 A221T probably damaging Het
Arhgef1 C T 7: 24,919,749 Q472* probably null Het
Arhgef1 C T 7: 24,907,662 probably benign Het
Calr3 C T 8: 72,427,179 G298S probably damaging Het
Chrng A G 1: 87,205,996 T15A unknown Het
CK137956 T A 4: 127,951,282 K223* probably null Het
Clca3b A T 3: 144,847,174 S97T probably benign Het
Cops7b G T 1: 86,587,194 G102V probably damaging Het
Dennd1a T A 2: 37,858,060 S382C probably damaging Het
Fdps G A 3: 89,099,386 Q66* probably null Het
Gemin4 T C 11: 76,212,913 T341A probably benign Het
Gm37596 G A 3: 93,692,145 Q306* probably null Het
Grk3 A G 5: 112,961,489 S201P unknown Het
Hgf C T 5: 16,602,331 T407I probably damaging Het
Hip1r C T 5: 123,997,227 R446C probably damaging Het
Hyal6 A T 6: 24,740,828 I327L possibly damaging Het
Ifna15 T C 4: 88,557,683 E188G possibly damaging Het
Igip A G 18: 36,301,213 S11G probably benign Het
Igkv5-39 A G 6: 69,900,605 Y56H probably damaging Het
Jph1 G A 1: 17,016,155 T381I probably damaging Het
Lrrc55 T C 2: 85,191,915 I311V probably benign Het
Mrps35 T A 6: 147,048,163 D58E probably benign Het
Ms4a4d C A 19: 11,557,946 P203T probably benign Het
Naip1 T G 13: 100,437,375 E225D possibly damaging Het
Ncapg2 T A 12: 116,444,347 I989N possibly damaging Het
Nek3 A T 8: 22,157,020 Y166* probably null Het
Nphs1 A G 7: 30,482,053 E1169G probably benign Het
Nudt15 G A 14: 73,521,659 P123L probably benign Het
Olfr1491 G A 19: 13,705,220 C131Y probably damaging Het
Olfr160 C T 9: 37,712,073 V69M probably benign Het
Olfr204 T C 16: 59,314,544 I288V possibly damaging Het
Olfr427 T A 1: 174,100,171 S238T probably damaging Het
Olfr95 T A 17: 37,211,316 E179V probably damaging Het
Pcdha5 T C 18: 36,960,641 S68P possibly damaging Het
Plec G T 15: 76,190,573 A330E unknown Het
Rpa3 A C 6: 8,256,790 I63S probably damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Snap25 A T 2: 136,769,828 K83N probably benign Het
Sos1 T G 17: 80,408,602 Q977P probably damaging Het
Spag16 A G 1: 70,381,302 Y483C probably damaging Het
Speg A G 1: 75,422,995 E2362G probably damaging Het
Swap70 A G 7: 110,255,877 D128G probably damaging Het
Syngap1 G A 17: 26,958,180 M545I probably damaging Het
Tmem147 T C 7: 30,728,447 E110G probably damaging Het
Tmem156 T A 5: 65,075,755 I155F probably benign Het
Ttc7b T C 12: 100,446,872 Y229C probably damaging Het
Utrn T A 10: 12,682,410 Q1435L probably damaging Het
Zbtb41 T C 1: 139,423,217 S23P probably benign Het
Zeb2 T A 2: 44,989,130 I1075F probably damaging Het
Other mutations in Trim25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01707:Trim25 APN 11 88999691 missense probably damaging 0.96
IGL02398:Trim25 APN 11 88999804 missense probably damaging 1.00
IGL03150:Trim25 APN 11 89000005 missense probably damaging 1.00
R0003:Trim25 UTSW 11 89015772 missense probably benign 0.01
R0184:Trim25 UTSW 11 88999640 missense probably damaging 1.00
R0707:Trim25 UTSW 11 88999738 missense probably benign 0.03
R1855:Trim25 UTSW 11 89015581 missense probably benign 0.04
R1936:Trim25 UTSW 11 89004750 missense probably benign 0.03
R2229:Trim25 UTSW 11 89016621 missense probably damaging 0.97
R3401:Trim25 UTSW 11 89010881 missense probably benign
R5159:Trim25 UTSW 11 88999532 missense probably benign 0.20
R5378:Trim25 UTSW 11 89009267 missense probably damaging 1.00
R6149:Trim25 UTSW 11 89015536 missense probably benign 0.00
R6867:Trim25 UTSW 11 89010887 missense probably benign 0.00
R6996:Trim25 UTSW 11 88999503 missense probably benign 0.00
R7055:Trim25 UTSW 11 88999924 missense probably benign
R7310:Trim25 UTSW 11 89015782 missense probably benign 0.03
R7451:Trim25 UTSW 11 89015737 missense possibly damaging 0.76
R7632:Trim25 UTSW 11 89015776 missense probably null 0.91
R7767:Trim25 UTSW 11 89009117 critical splice acceptor site probably null
X0022:Trim25 UTSW 11 89015596 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AAGAACAACTTCTGCGGCG -3'
(R):5'- CAGAGTTCCCTCCAGTCTTG -3'

Sequencing Primer
(F):5'- CTACGGCAGCATGGAACG -3'
(R):5'- AGTCTTGGATGTTCCCCAGCAAG -3'
Posted On2020-06-30