Incidental Mutation 'R8132:Ncapg2'
ID632084
Institutional Source Beutler Lab
Gene Symbol Ncapg2
Ensembl Gene ENSMUSG00000042029
Gene Namenon-SMC condensin II complex, subunit G2
SynonymsLuzp5, 5830426I05Rik, mCAP-G2, Mtb
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8132 (G1)
Quality Score194.009
Status Not validated
Chromosome12
Chromosomal Location116405402-116463731 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 116444347 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 989 (I989N)
Ref Sequence ENSEMBL: ENSMUSP00000081889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084828]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084828
AA Change: I989N

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000081889
Gene: ENSMUSG00000042029
AA Change: I989N

DomainStartEndE-ValueType
low complexity region 14 25 N/A INTRINSIC
Pfam:Condensin2nSMC 212 361 7.2e-62 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the Condensin2nSMC family of proteins. The encoded protein is a regulatory subunit of the condensin II complex which, along with the condensin I complex, plays a role in chromosome assembly and segregation during mitosis. A similar protein in mouse is required for early development of the embryo. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous null embryos exhibit impaired inner cell mass expansion and die shortly after implantation and prior to gastrulation and blood cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,965,018 A403T Het
Abhd16b G A 2: 181,493,967 A221T probably damaging Het
Arhgef1 C T 7: 24,919,749 Q472* probably null Het
Arhgef1 C T 7: 24,907,662 probably benign Het
Calr3 C T 8: 72,427,179 G298S probably damaging Het
Chrng A G 1: 87,205,996 T15A unknown Het
CK137956 T A 4: 127,951,282 K223* probably null Het
Clca3b A T 3: 144,847,174 S97T probably benign Het
Cops7b G T 1: 86,587,194 G102V probably damaging Het
Dennd1a T A 2: 37,858,060 S382C probably damaging Het
Fdps G A 3: 89,099,386 Q66* probably null Het
Gemin4 T C 11: 76,212,913 T341A probably benign Het
Gm37596 G A 3: 93,692,145 Q306* probably null Het
Grk3 A G 5: 112,961,489 S201P unknown Het
Hgf C T 5: 16,602,331 T407I probably damaging Het
Hip1r C T 5: 123,997,227 R446C probably damaging Het
Hyal6 A T 6: 24,740,828 I327L possibly damaging Het
Ifna15 T C 4: 88,557,683 E188G possibly damaging Het
Igip A G 18: 36,301,213 S11G probably benign Het
Igkv5-39 A G 6: 69,900,605 Y56H probably damaging Het
Jph1 G A 1: 17,016,155 T381I probably damaging Het
Lrrc55 T C 2: 85,191,915 I311V probably benign Het
Mrps35 T A 6: 147,048,163 D58E probably benign Het
Ms4a4d C A 19: 11,557,946 P203T probably benign Het
Naip1 T G 13: 100,437,375 E225D possibly damaging Het
Nek3 A T 8: 22,157,020 Y166* probably null Het
Nphs1 A G 7: 30,482,053 E1169G probably benign Het
Nudt15 G A 14: 73,521,659 P123L probably benign Het
Olfr1491 G A 19: 13,705,220 C131Y probably damaging Het
Olfr160 C T 9: 37,712,073 V69M probably benign Het
Olfr204 T C 16: 59,314,544 I288V possibly damaging Het
Olfr427 T A 1: 174,100,171 S238T probably damaging Het
Olfr95 T A 17: 37,211,316 E179V probably damaging Het
Pcdha5 T C 18: 36,960,641 S68P possibly damaging Het
Plec G T 15: 76,190,573 A330E unknown Het
Rpa3 A C 6: 8,256,790 I63S probably damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Snap25 A T 2: 136,769,828 K83N probably benign Het
Sos1 T G 17: 80,408,602 Q977P probably damaging Het
Spag16 A G 1: 70,381,302 Y483C probably damaging Het
Speg A G 1: 75,422,995 E2362G probably damaging Het
Swap70 A G 7: 110,255,877 D128G probably damaging Het
Syngap1 G A 17: 26,958,180 M545I probably damaging Het
Tmem147 T C 7: 30,728,447 E110G probably damaging Het
Tmem156 T A 5: 65,075,755 I155F probably benign Het
Trim25 C A 11: 89,016,606 A597E probably damaging Het
Ttc7b T C 12: 100,446,872 Y229C probably damaging Het
Utrn T A 10: 12,682,410 Q1435L probably damaging Het
Zbtb41 T C 1: 139,423,217 S23P probably benign Het
Zeb2 T A 2: 44,989,130 I1075F probably damaging Het
Other mutations in Ncapg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Ncapg2 APN 12 116424650 missense possibly damaging 0.54
IGL01694:Ncapg2 APN 12 116407230 utr 5 prime probably benign
IGL01724:Ncapg2 APN 12 116426711 missense probably damaging 1.00
IGL01792:Ncapg2 APN 12 116425818 missense probably damaging 0.99
IGL02098:Ncapg2 APN 12 116444332 missense possibly damaging 0.59
IGL02136:Ncapg2 APN 12 116460583 missense probably benign
IGL02409:Ncapg2 APN 12 116420717 missense probably damaging 1.00
IGL02580:Ncapg2 APN 12 116420689 missense probably damaging 1.00
IGL02653:Ncapg2 APN 12 116425906 critical splice donor site probably null
IGL03073:Ncapg2 APN 12 116452274 missense probably benign 0.01
IGL03114:Ncapg2 APN 12 116452373 splice site probably benign
IGL03199:Ncapg2 APN 12 116419236 missense probably damaging 1.00
IGL03328:Ncapg2 APN 12 116440057 missense possibly damaging 0.90
P0033:Ncapg2 UTSW 12 116438635 missense probably benign 0.03
R0008:Ncapg2 UTSW 12 116429835 missense probably damaging 1.00
R0194:Ncapg2 UTSW 12 116420683 splice site probably null
R0379:Ncapg2 UTSW 12 116443075 missense probably damaging 1.00
R0568:Ncapg2 UTSW 12 116423215 missense probably damaging 1.00
R0771:Ncapg2 UTSW 12 116413159 nonsense probably null
R1016:Ncapg2 UTSW 12 116438675 missense probably damaging 1.00
R1507:Ncapg2 UTSW 12 116460566 missense probably benign 0.00
R1524:Ncapg2 UTSW 12 116434578 splice site probably benign
R1596:Ncapg2 UTSW 12 116419236 missense probably damaging 1.00
R1635:Ncapg2 UTSW 12 116434685 frame shift probably null
R1752:Ncapg2 UTSW 12 116426718 missense probably damaging 1.00
R2164:Ncapg2 UTSW 12 116450475 splice site probably null
R2266:Ncapg2 UTSW 12 116429676 missense probably damaging 1.00
R2366:Ncapg2 UTSW 12 116420729 nonsense probably null
R2924:Ncapg2 UTSW 12 116438729 missense probably benign 0.03
R2925:Ncapg2 UTSW 12 116438729 missense probably benign 0.03
R3828:Ncapg2 UTSW 12 116407318 splice site probably benign
R3829:Ncapg2 UTSW 12 116407318 splice site probably benign
R4384:Ncapg2 UTSW 12 116439877 critical splice donor site probably null
R4651:Ncapg2 UTSW 12 116425787 missense probably damaging 1.00
R4701:Ncapg2 UTSW 12 116440618 missense probably benign
R4821:Ncapg2 UTSW 12 116415457 missense probably damaging 0.99
R4845:Ncapg2 UTSW 12 116440588 missense probably damaging 0.96
R5135:Ncapg2 UTSW 12 116427786 missense possibly damaging 0.64
R5294:Ncapg2 UTSW 12 116427794 missense possibly damaging 0.54
R5334:Ncapg2 UTSW 12 116426637 missense probably damaging 1.00
R5588:Ncapg2 UTSW 12 116413077 missense possibly damaging 0.95
R5888:Ncapg2 UTSW 12 116425800 missense possibly damaging 0.84
R5938:Ncapg2 UTSW 12 116429657 missense probably damaging 1.00
R5978:Ncapg2 UTSW 12 116424671 missense possibly damaging 0.68
R6016:Ncapg2 UTSW 12 116426607 missense probably damaging 1.00
R6026:Ncapg2 UTSW 12 116443021 missense possibly damaging 0.73
R6155:Ncapg2 UTSW 12 116438011 missense possibly damaging 0.83
R6509:Ncapg2 UTSW 12 116427756 missense probably damaging 1.00
R6675:Ncapg2 UTSW 12 116434661 missense possibly damaging 0.71
R6912:Ncapg2 UTSW 12 116426582 missense probably benign
R7069:Ncapg2 UTSW 12 116424717 splice site probably null
R7339:Ncapg2 UTSW 12 116414834 missense probably damaging 0.96
R7440:Ncapg2 UTSW 12 116450413 missense possibly damaging 0.89
R7445:Ncapg2 UTSW 12 116419268 missense possibly damaging 0.50
R7704:Ncapg2 UTSW 12 116419277 missense probably damaging 1.00
R8061:Ncapg2 UTSW 12 116426577 missense probably benign
R8166:Ncapg2 UTSW 12 116412416 missense probably benign 0.00
X0020:Ncapg2 UTSW 12 116424707 missense probably damaging 1.00
Z1177:Ncapg2 UTSW 12 116438605 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TATCCTGCCTGAGCTGATGG -3'
(R):5'- GATGGCATCCTCAGCACATG -3'

Sequencing Primer
(F):5'- TTGGCCTGGAACTCACAATG -3'
(R):5'- AGCCAACCAGCTGAATGG -3'
Posted On2020-06-30