Incidental Mutation 'R8132:Syngap1'
ID632089
Institutional Source Beutler Lab
Gene Symbol Syngap1
Ensembl Gene ENSMUSG00000067629
Gene Namesynaptic Ras GTPase activating protein 1 homolog (rat)
SynonymsSyngap
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8132 (G1)
Quality Score207.009
Status Not validated
Chromosome17
Chromosomal Location26941253-26972434 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 26958180 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 545 (M545I)
Ref Sequence ENSEMBL: ENSMUSP00000141686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081285] [ENSMUST00000177932] [ENSMUST00000194598] [ENSMUST00000201702] [ENSMUST00000202939] [ENSMUST00000228963] [ENSMUST00000229490] [ENSMUST00000231853]
Predicted Effect probably damaging
Transcript: ENSMUST00000081285
AA Change: M486I

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000080038
Gene: ENSMUSG00000067629
AA Change: M486I

DomainStartEndE-ValueType
PH 27 253 3.23e-8 SMART
C2 263 362 7.4e-10 SMART
RasGAP 392 729 3.33e-118 SMART
low complexity region 787 803 N/A INTRINSIC
low complexity region 938 973 N/A INTRINSIC
low complexity region 1040 1068 N/A INTRINSIC
low complexity region 1110 1125 N/A INTRINSIC
coiled coil region 1186 1259 N/A INTRINSIC
low complexity region 1308 1326 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177932
AA Change: M545I

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000137587
Gene: ENSMUSG00000067629
AA Change: M545I

DomainStartEndE-ValueType
PH 27 253 3.23e-8 SMART
C2 263 362 7.4e-10 SMART
RasGAP 392 729 3.33e-118 SMART
low complexity region 787 803 N/A INTRINSIC
low complexity region 938 973 N/A INTRINSIC
low complexity region 1040 1068 N/A INTRINSIC
low complexity region 1110 1125 N/A INTRINSIC
coiled coil region 1186 1259 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000141245
Gene: ENSMUSG00000067629
AA Change: M529I

DomainStartEndE-ValueType
PH 12 238 1.5e-10 SMART
C2 248 347 4.8e-12 SMART
RasGAP 377 714 2.1e-120 SMART
low complexity region 772 788 N/A INTRINSIC
low complexity region 923 958 N/A INTRINSIC
low complexity region 1025 1053 N/A INTRINSIC
low complexity region 1095 1110 N/A INTRINSIC
coiled coil region 1171 1244 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000194598
AA Change: M545I

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141686
Gene: ENSMUSG00000067629
AA Change: M545I

DomainStartEndE-ValueType
PH 27 253 3.23e-8 SMART
C2 263 362 7.4e-10 SMART
RasGAP 392 729 3.33e-118 SMART
low complexity region 787 803 N/A INTRINSIC
low complexity region 938 973 N/A INTRINSIC
low complexity region 1040 1068 N/A INTRINSIC
low complexity region 1110 1125 N/A INTRINSIC
coiled coil region 1186 1259 N/A INTRINSIC
low complexity region 1308 1326 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201186
Predicted Effect
SMART Domains Protein: ENSMUSP00000144666
Gene: ENSMUSG00000067629
AA Change: M544I

DomainStartEndE-ValueType
RasGAP 9 346 2.2e-120 SMART
low complexity region 404 420 N/A INTRINSIC
low complexity region 555 590 N/A INTRINSIC
low complexity region 657 685 N/A INTRINSIC
low complexity region 727 742 N/A INTRINSIC
Blast:RasGAP 761 876 3e-21 BLAST
low complexity region 884 894 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000144248
Gene: ENSMUSG00000067629
AA Change: M545I

DomainStartEndE-ValueType
PH 27 253 1.5e-10 SMART
C2 263 362 4.9e-12 SMART
RasGAP 392 729 2.2e-120 SMART
low complexity region 773 789 N/A INTRINSIC
low complexity region 924 959 N/A INTRINSIC
low complexity region 1026 1054 N/A INTRINSIC
low complexity region 1096 1111 N/A INTRINSIC
coiled coil region 1171 1243 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202049
Predicted Effect probably benign
Transcript: ENSMUST00000202208
Predicted Effect probably damaging
Transcript: ENSMUST00000202939
AA Change: M52I

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144403
Gene: ENSMUSG00000067629
AA Change: M52I

DomainStartEndE-ValueType
Pfam:RasGAP 1 61 5.7e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000228963
AA Change: M486I

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000229490
AA Change: M545I

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000231853
AA Change: M372I

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a Ras GTPase activating protein that is a member of the N-methyl-D-aspartate receptor complex. The N-terminal domain of the protein contains a Ras-GAP domain, a pleckstrin homology domain, and a C2 domain that may be involved in binding of calcium and phospholipids. The C-terminal domain consists of a ten histidine repeat region, serine and tyrosine phosphorylation sites, and a T/SXV motif required for postsynaptic scaffold protein interaction. The encoded protein negatively regulates Ras, Rap and alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor trafficking to the postsynaptic membrane to regulate synaptic plasticity and neuronal homeostasis. Homozygous null mutations result in early post-embryonic lethality, while heterozygous mutant mice display a variety of phenotypes that include learning and memory defects, hyperactivity, and audiogenic seizures. [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygous mutant mice exhibit postnatal lethality, and by P3-P4, exhibit small body size and brain, reduced movement and do not feed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,965,018 A403T Het
Abhd16b G A 2: 181,493,967 A221T probably damaging Het
Arhgef1 C T 7: 24,907,662 probably benign Het
Arhgef1 C T 7: 24,919,749 Q472* probably null Het
Calr3 C T 8: 72,427,179 G298S probably damaging Het
Chrng A G 1: 87,205,996 T15A unknown Het
CK137956 T A 4: 127,951,282 K223* probably null Het
Clca3b A T 3: 144,847,174 S97T probably benign Het
Cops7b G T 1: 86,587,194 G102V probably damaging Het
Dennd1a T A 2: 37,858,060 S382C probably damaging Het
Fdps G A 3: 89,099,386 Q66* probably null Het
Gemin4 T C 11: 76,212,913 T341A probably benign Het
Gm37596 G A 3: 93,692,145 Q306* probably null Het
Grk3 A G 5: 112,961,489 S201P unknown Het
Hgf C T 5: 16,602,331 T407I probably damaging Het
Hip1r C T 5: 123,997,227 R446C probably damaging Het
Hyal6 A T 6: 24,740,828 I327L possibly damaging Het
Ifna15 T C 4: 88,557,683 E188G possibly damaging Het
Igip A G 18: 36,301,213 S11G probably benign Het
Igkv5-39 A G 6: 69,900,605 Y56H probably damaging Het
Jph1 G A 1: 17,016,155 T381I probably damaging Het
Lrrc55 T C 2: 85,191,915 I311V probably benign Het
Mrps35 T A 6: 147,048,163 D58E probably benign Het
Ms4a4d C A 19: 11,557,946 P203T probably benign Het
Naip1 T G 13: 100,437,375 E225D possibly damaging Het
Ncapg2 T A 12: 116,444,347 I989N possibly damaging Het
Nek3 A T 8: 22,157,020 Y166* probably null Het
Nphs1 A G 7: 30,482,053 E1169G probably benign Het
Nudt15 G A 14: 73,521,659 P123L probably benign Het
Olfr1491 G A 19: 13,705,220 C131Y probably damaging Het
Olfr160 C T 9: 37,712,073 V69M probably benign Het
Olfr204 T C 16: 59,314,544 I288V possibly damaging Het
Olfr427 T A 1: 174,100,171 S238T probably damaging Het
Olfr95 T A 17: 37,211,316 E179V probably damaging Het
Pcdha5 T C 18: 36,960,641 S68P possibly damaging Het
Plec G T 15: 76,190,573 A330E unknown Het
Rpa3 A C 6: 8,256,790 I63S probably damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Snap25 A T 2: 136,769,828 K83N probably benign Het
Sos1 T G 17: 80,408,602 Q977P probably damaging Het
Spag16 A G 1: 70,381,302 Y483C probably damaging Het
Speg A G 1: 75,422,995 E2362G probably damaging Het
Swap70 A G 7: 110,255,877 D128G probably damaging Het
Tmem147 T C 7: 30,728,447 E110G probably damaging Het
Tmem156 T A 5: 65,075,755 I155F probably benign Het
Trim25 C A 11: 89,016,606 A597E probably damaging Het
Ttc7b T C 12: 100,446,872 Y229C probably damaging Het
Utrn T A 10: 12,682,410 Q1435L probably damaging Het
Zbtb41 T C 1: 139,423,217 S23P probably benign Het
Zeb2 T A 2: 44,989,130 I1075F probably damaging Het
Other mutations in Syngap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0732:Syngap1 UTSW 17 26954988 missense possibly damaging 0.94
R1178:Syngap1 UTSW 17 26957805 missense probably damaging 0.99
R1680:Syngap1 UTSW 17 26952579 missense possibly damaging 0.60
R1953:Syngap1 UTSW 17 26944687 missense possibly damaging 0.94
R2213:Syngap1 UTSW 17 26953069 missense probably damaging 1.00
R2696:Syngap1 UTSW 17 26957411 nonsense probably null
R2899:Syngap1 UTSW 17 26959985 missense probably damaging 1.00
R3237:Syngap1 UTSW 17 26957093 nonsense probably null
R3705:Syngap1 UTSW 17 26960020 missense probably damaging 1.00
R3880:Syngap1 UTSW 17 26953064 missense probably damaging 1.00
R4019:Syngap1 UTSW 17 26952341 unclassified probably benign
R4661:Syngap1 UTSW 17 26966906 missense probably damaging 1.00
R4798:Syngap1 UTSW 17 26961449 missense probably benign 0.00
R5524:Syngap1 UTSW 17 26957152 missense probably damaging 1.00
R5580:Syngap1 UTSW 17 26962331 missense probably damaging 0.97
R5610:Syngap1 UTSW 17 26959780 missense possibly damaging 0.68
R5835:Syngap1 UTSW 17 26958218 missense probably benign 0.09
R5974:Syngap1 UTSW 17 26963038 missense probably damaging 0.98
R6235:Syngap1 UTSW 17 26958130 missense probably benign 0.00
R6247:Syngap1 UTSW 17 26962957 nonsense probably null
R6461:Syngap1 UTSW 17 26964848 missense probably damaging 1.00
R6503:Syngap1 UTSW 17 26944684 missense probably benign 0.40
R7134:Syngap1 UTSW 17 26960011 missense probably damaging 1.00
R7248:Syngap1 UTSW 17 26957767 missense probably damaging 1.00
R7298:Syngap1 UTSW 17 26962987 missense possibly damaging 0.85
R7749:Syngap1 UTSW 17 26959964 missense probably damaging 0.99
R7812:Syngap1 UTSW 17 26941504 missense probably benign
R7864:Syngap1 UTSW 17 26970528 missense
R7951:Syngap1 UTSW 17 26966968 missense possibly damaging 0.46
R8024:Syngap1 UTSW 17 26941452 start codon destroyed probably benign 0.01
R8386:Syngap1 UTSW 17 26960491 missense possibly damaging 0.60
X0017:Syngap1 UTSW 17 26944651 missense probably benign 0.11
Z1088:Syngap1 UTSW 17 26961576 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCTCCAACCATCTGATTC -3'
(R):5'- CATCTGAGGTCAGGAAGCAG -3'

Sequencing Primer
(F):5'- AACCATCTGATTCTGCCATTCC -3'
(R):5'- GTCAGGAAGCAGCCCTCATTC -3'
Posted On2020-06-30