Incidental Mutation 'R8132:Olfr1491'
ID632095
Institutional Source Beutler Lab
Gene Symbol Olfr1491
Ensembl Gene ENSMUSG00000051156
Gene Nameolfactory receptor 1491
SynonymsGA_x6K02T2RE5P-4037809-4038768, MOR266-8
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8132 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location13697268-13706127 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 13705220 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 131 (C131Y)
Ref Sequence ENSEMBL: ENSMUSP00000151038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052737] [ENSMUST00000214007] [ENSMUST00000215493] [ENSMUST00000216366] [ENSMUST00000216377] [ENSMUST00000216622]
Predicted Effect probably damaging
Transcript: ENSMUST00000052737
AA Change: C131Y

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000057902
Gene: ENSMUSG00000051156
AA Change: C131Y

DomainStartEndE-ValueType
Pfam:7tm_4 35 314 3.3e-52 PFAM
Pfam:7tm_1 45 295 5.9e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214007
AA Change: C131Y

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000215493
AA Change: C131Y

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000216366
AA Change: C131Y

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000216377
AA Change: C131Y

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000216622
AA Change: C131Y

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,965,018 A403T Het
Abhd16b G A 2: 181,493,967 A221T probably damaging Het
Arhgef1 C T 7: 24,907,662 probably benign Het
Arhgef1 C T 7: 24,919,749 Q472* probably null Het
Calr3 C T 8: 72,427,179 G298S probably damaging Het
Chrng A G 1: 87,205,996 T15A unknown Het
CK137956 T A 4: 127,951,282 K223* probably null Het
Clca3b A T 3: 144,847,174 S97T probably benign Het
Cops7b G T 1: 86,587,194 G102V probably damaging Het
Dennd1a T A 2: 37,858,060 S382C probably damaging Het
Fdps G A 3: 89,099,386 Q66* probably null Het
Gemin4 T C 11: 76,212,913 T341A probably benign Het
Gm37596 G A 3: 93,692,145 Q306* probably null Het
Grk3 A G 5: 112,961,489 S201P unknown Het
Hgf C T 5: 16,602,331 T407I probably damaging Het
Hip1r C T 5: 123,997,227 R446C probably damaging Het
Hyal6 A T 6: 24,740,828 I327L possibly damaging Het
Ifna15 T C 4: 88,557,683 E188G possibly damaging Het
Igip A G 18: 36,301,213 S11G probably benign Het
Igkv5-39 A G 6: 69,900,605 Y56H probably damaging Het
Jph1 G A 1: 17,016,155 T381I probably damaging Het
Lrrc55 T C 2: 85,191,915 I311V probably benign Het
Mrps35 T A 6: 147,048,163 D58E probably benign Het
Ms4a4d C A 19: 11,557,946 P203T probably benign Het
Naip1 T G 13: 100,437,375 E225D possibly damaging Het
Ncapg2 T A 12: 116,444,347 I989N possibly damaging Het
Nek3 A T 8: 22,157,020 Y166* probably null Het
Nphs1 A G 7: 30,482,053 E1169G probably benign Het
Nudt15 G A 14: 73,521,659 P123L probably benign Het
Olfr160 C T 9: 37,712,073 V69M probably benign Het
Olfr204 T C 16: 59,314,544 I288V possibly damaging Het
Olfr427 T A 1: 174,100,171 S238T probably damaging Het
Olfr95 T A 17: 37,211,316 E179V probably damaging Het
Pcdha5 T C 18: 36,960,641 S68P possibly damaging Het
Plec G T 15: 76,190,573 A330E unknown Het
Rpa3 A C 6: 8,256,790 I63S probably damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Het
Snap25 A T 2: 136,769,828 K83N probably benign Het
Sos1 T G 17: 80,408,602 Q977P probably damaging Het
Spag16 A G 1: 70,381,302 Y483C probably damaging Het
Speg A G 1: 75,422,995 E2362G probably damaging Het
Swap70 A G 7: 110,255,877 D128G probably damaging Het
Syngap1 G A 17: 26,958,180 M545I probably damaging Het
Tmem147 T C 7: 30,728,447 E110G probably damaging Het
Tmem156 T A 5: 65,075,755 I155F probably benign Het
Trim25 C A 11: 89,016,606 A597E probably damaging Het
Ttc7b T C 12: 100,446,872 Y229C probably damaging Het
Utrn T A 10: 12,682,410 Q1435L probably damaging Het
Zbtb41 T C 1: 139,423,217 S23P probably benign Het
Zeb2 T A 2: 44,989,130 I1075F probably damaging Het
Other mutations in Olfr1491
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00958:Olfr1491 APN 19 13705732 missense probably benign 0.05
IGL02713:Olfr1491 APN 19 13705189 missense possibly damaging 0.78
IGL02822:Olfr1491 APN 19 13705655 missense probably benign 0.13
R0083:Olfr1491 UTSW 19 13705678 missense probably damaging 0.99
R0108:Olfr1491 UTSW 19 13705678 missense probably damaging 0.99
R0271:Olfr1491 UTSW 19 13705135 missense probably benign 0.03
R1364:Olfr1491 UTSW 19 13705445 missense probably benign 0.11
R1538:Olfr1491 UTSW 19 13705496 missense probably damaging 1.00
R1575:Olfr1491 UTSW 19 13705525 missense probably benign 0.00
R1579:Olfr1491 UTSW 19 13705202 missense probably damaging 1.00
R2179:Olfr1491 UTSW 19 13705394 missense probably damaging 0.98
R4393:Olfr1491 UTSW 19 13705190 missense possibly damaging 0.50
R5837:Olfr1491 UTSW 19 13704960 nonsense probably null
R6001:Olfr1491 UTSW 19 13705060 missense probably damaging 0.98
R8064:Olfr1491 UTSW 19 13705022 missense probably damaging 1.00
R8294:Olfr1491 UTSW 19 13705646 missense probably benign 0.02
R8380:Olfr1491 UTSW 19 13705244 missense probably benign 0.11
Z1176:Olfr1491 UTSW 19 13705203 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCTGTCTTTCCTGGAAATATGC -3'
(R):5'- CCTGGTGCACATGAATGTCAG -3'

Sequencing Primer
(F):5'- TTTCCTGGAAATATGCTACACCACAG -3'
(R):5'- TGCACATGAATGTCAGCACAG -3'
Posted On2020-06-30