Incidental Mutation 'R0011:Art3'
ID63211
Institutional Source Beutler Lab
Gene Symbol Art3
Ensembl Gene ENSMUSG00000034842
Gene NameADP-ribosyltransferase 3
Synonyms4930569O04Rik
MMRRC Submission 038306-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R0011 (G1)
Quality Score112
Status Validated
Chromosome5
Chromosomal Location92331827-92414628 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 92403612 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 17 (Y17N)
Ref Sequence ENSEMBL: ENSMUSP00000114826 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113083] [ENSMUST00000117108] [ENSMUST00000118106] [ENSMUST00000119587] [ENSMUST00000120193] [ENSMUST00000120416] [ENSMUST00000121096] [ENSMUST00000152041]
Predicted Effect probably benign
Transcript: ENSMUST00000113083
AA Change: Y277N

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000108706
Gene: ENSMUSG00000034842
AA Change: Y277N

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ART 29 251 4.4e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117108
AA Change: Y277N

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000113041
Gene: ENSMUSG00000034842
AA Change: Y277N

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ART 29 251 1.9e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118106
AA Change: Y277N

PolyPhen 2 Score 0.348 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000114083
Gene: ENSMUSG00000034842
AA Change: Y277N

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ART 29 251 9e-66 PFAM
low complexity region 298 309 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119587
SMART Domains Protein: ENSMUSP00000112648
Gene: ENSMUSG00000034842

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ART 29 251 4e-65 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000120193
AA Change: Y277N

PolyPhen 2 Score 0.552 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113074
Gene: ENSMUSG00000034842
AA Change: Y277N

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ART 29 251 8.4e-66 PFAM
low complexity region 298 309 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120416
AA Change: Y277N

PolyPhen 2 Score 0.348 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000113493
Gene: ENSMUSG00000034842
AA Change: Y277N

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ART 29 251 3.1e-65 PFAM
low complexity region 298 309 N/A INTRINSIC
low complexity region 366 373 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121096
AA Change: Y277N

PolyPhen 2 Score 0.379 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000113510
Gene: ENSMUSG00000034842
AA Change: Y277N

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ART 29 251 1.8e-65 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000126281
AA Change: Y215N
SMART Domains Protein: ENSMUSP00000116110
Gene: ENSMUSG00000034842
AA Change: Y215N

DomainStartEndE-ValueType
Pfam:ART 1 190 3e-53 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129222
Predicted Effect unknown
Transcript: ENSMUST00000138003
AA Change: Y57N
Predicted Effect probably damaging
Transcript: ENSMUST00000152041
AA Change: Y17N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Meta Mutation Damage Score 0.3359 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an arginine-specific ADP-ribosyltransferase. The encoded protein catalyzes a reversible reaction which modifies proteins by the addition or removal of ADP-ribose to an arginine residue to regulate the function of the modified protein. An ADP-ribosyltransferase pseudogene is located on chromosome 11. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik T A 7: 131,229,993 L389Q probably damaging Het
A930011G23Rik T C 5: 99,232,354 Y344C probably damaging Het
Alox15 A G 11: 70,349,596 V253A possibly damaging Het
Ank3 A G 10: 69,979,451 probably benign Het
Asic3 C T 5: 24,417,492 probably benign Het
Bach2 G T 4: 32,244,655 probably benign Het
Brip1 C A 11: 86,186,998 K201N possibly damaging Het
Casc1 T A 6: 145,179,055 M515L probably damaging Het
Ccdc88a T C 11: 29,374,364 F6S probably damaging Het
Celsr2 A G 3: 108,413,402 I698T probably benign Het
Cenpf A G 1: 189,650,706 S2664P probably benign Het
Cfap54 A T 10: 93,065,225 C156S probably damaging Het
Cops4 C A 5: 100,527,981 Q28K probably benign Het
Cyb5a T A 18: 84,877,822 probably benign Het
Diaph3 A T 14: 86,866,408 C847S probably damaging Het
Dnah3 T C 7: 120,019,701 K1648R probably damaging Het
Emilin2 C T 17: 71,273,868 G621E probably benign Het
Enpp1 T A 10: 24,670,002 K228* probably null Het
Epg5 T C 18: 77,948,483 C132R probably benign Het
Epha7 G A 4: 28,962,564 D961N probably benign Het
G6pc2 C A 2: 69,226,565 probably benign Het
Gm7361 C T 5: 26,258,878 probably benign Het
Grin2c T C 11: 115,255,750 Y476C probably damaging Het
Hnrnpul1 T G 7: 25,742,915 probably benign Het
Igf2bp1 T C 11: 96,005,584 D17G probably damaging Het
Insrr T C 3: 87,809,616 C688R possibly damaging Het
Itgb2l T C 16: 96,427,661 probably benign Het
Kidins220 T A 12: 24,999,352 V322E probably damaging Het
Klk1 C T 7: 44,229,535 T149I probably benign Het
Mbd3l1 A G 9: 18,484,567 probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mrc1 T C 2: 14,261,337 probably null Het
Mtr T C 13: 12,238,052 probably benign Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Npy4r C T 14: 34,146,723 V203M probably damaging Het
Olfr965 T A 9: 39,719,627 N133K probably benign Het
Pik3r4 C A 9: 105,644,637 T134K probably benign Het
Rdh19 T A 10: 127,856,911 L149Q probably damaging Het
Sema3e C T 5: 14,144,011 R85* probably null Het
Shtn1 A G 19: 59,032,218 S191P possibly damaging Het
Slc39a11 A T 11: 113,247,833 F279L probably benign Het
Slc4a1 T C 11: 102,357,110 K353E possibly damaging Het
Slc6a18 A T 13: 73,665,619 M515K possibly damaging Het
Snapc4 A G 2: 26,364,813 I1225T probably benign Het
Spidr A T 16: 15,966,603 W534R probably benign Het
Tmem202 T A 9: 59,524,801 N81I probably benign Het
Tnfrsf1b T G 4: 145,222,966 R297S possibly damaging Het
Trim55 A G 3: 19,670,999 T227A probably benign Het
Trim58 A T 11: 58,643,120 T167S probably benign Het
Trp53i11 A T 2: 93,199,353 probably benign Het
Ttn T C 2: 76,810,355 H5356R probably damaging Het
Tyrp1 C T 4: 80,840,793 T301I probably damaging Het
Wdr17 A T 8: 54,672,501 I448K possibly damaging Het
Wscd1 T C 11: 71,788,828 V509A probably damaging Het
Zfp251 A G 15: 76,854,554 V108A probably benign Het
Other mutations in Art3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01526:Art3 APN 5 92414340 missense probably damaging 0.99
IGL01674:Art3 APN 5 92403614 nonsense probably null
R0011:Art3 UTSW 5 92403612 missense probably damaging 0.99
R1861:Art3 UTSW 5 92412235 intron probably benign
R4131:Art3 UTSW 5 92392562 missense probably benign 0.01
R4726:Art3 UTSW 5 92411143 missense probably benign 0.10
R4810:Art3 UTSW 5 92414249 missense possibly damaging 0.84
R4959:Art3 UTSW 5 92403619 missense probably damaging 1.00
R4973:Art3 UTSW 5 92403619 missense probably damaging 1.00
R5592:Art3 UTSW 5 92392820 missense probably damaging 1.00
R5678:Art3 UTSW 5 92392550 missense probably damaging 0.99
R5813:Art3 UTSW 5 92412241 utr 3 prime probably benign
R5924:Art3 UTSW 5 92412232 intron probably benign
R6480:Art3 UTSW 5 92392817 missense probably damaging 1.00
R7452:Art3 UTSW 5 92392680 missense probably damaging 1.00
R7549:Art3 UTSW 5 92403655 missense probably benign 0.01
R7772:Art3 UTSW 5 92403613 missense probably damaging 0.99
Z1177:Art3 UTSW 5 92412206
Predicted Primers PCR Primer
(F):5'- GAGGCTCAGCGTTATCGAGTATGTC -3'
(R):5'- TTCACTGCTTAGAGGGCCACAGAG -3'

Sequencing Primer
(F):5'- AAAGTCTATATTGCCTTGTCCTTG -3'
(R):5'- GGCCACAGAGCAAATGC -3'
Posted On2013-07-30