Incidental Mutation 'R8133:AI987944'
ID 632115
Institutional Source Beutler Lab
Gene Symbol AI987944
Ensembl Gene ENSMUSG00000056383
Gene Name expressed sequence AI987944
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock # R8133 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 41372923-41393379 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 41375065 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145565 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071804] [ENSMUST00000205338] [ENSMUST00000206801]
AlphaFold Q7TPX5
Predicted Effect silent
Transcript: ENSMUST00000071804
SMART Domains Protein: ENSMUSP00000071708
Gene: ENSMUSG00000056383

DomainStartEndE-ValueType
KRAB 4 65 8.72e-15 SMART
ZnF_C2H2 74 96 1.24e2 SMART
ZnF_C2H2 130 152 2.43e-4 SMART
ZnF_C2H2 181 203 5.21e-4 SMART
ZnF_C2H2 209 231 3.95e-4 SMART
ZnF_C2H2 237 259 1.95e-3 SMART
ZnF_C2H2 265 287 4.87e-4 SMART
ZnF_C2H2 293 315 1.72e-4 SMART
ZnF_C2H2 321 343 8.47e-4 SMART
ZnF_C2H2 349 371 9.73e-4 SMART
ZnF_C2H2 377 399 3.69e-4 SMART
Predicted Effect silent
Transcript: ENSMUST00000205338
Predicted Effect probably null
Transcript: ENSMUST00000206801
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.9%
  • 20x: 96.3%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A T 11: 110,127,463 S1110R possibly damaging Het
Adam15 C T 3: 89,347,206 R123Q probably benign Het
Ankrd31 T C 13: 96,866,495 probably null Het
Arfgef3 C A 10: 18,611,203 probably null Het
Atp6v0c C T 17: 24,164,579 S98N possibly damaging Het
Camsap1 T C 2: 25,934,297 N1417S probably damaging Het
Cct7 T C 6: 85,461,063 S96P probably damaging Het
Cd38 C A 5: 43,901,448 L135M probably damaging Het
Cib4 T C 5: 30,534,218 D53G probably benign Het
Cntn6 T A 6: 104,728,337 S244T probably benign Het
Cubn G T 2: 13,388,848 D1447E probably damaging Het
Ebf3 T C 7: 137,313,143 E102G probably damaging Het
Elmo1 T A 13: 20,373,086 V399E probably damaging Het
Etl4 A G 2: 20,806,271 E1423G possibly damaging Het
Glis3 A G 19: 28,350,006 S669P probably benign Het
Gm609 T C 16: 45,443,941 T85A probably benign Het
Hipk1 T C 3: 103,753,394 T742A possibly damaging Het
Igdcc4 C A 9: 65,131,741 T890N possibly damaging Het
Jcad C T 18: 4,649,384 T85I probably benign Het
Kmt2d T C 15: 98,864,942 K316E probably damaging Het
Lrig1 T C 6: 94,611,629 D513G possibly damaging Het
Lrrn4 T C 2: 132,878,014 N289D probably damaging Het
Mcf2l A G 8: 13,011,487 M829V probably damaging Het
Mib2 C T 4: 155,657,001 R495H probably benign Het
Nqo2 T C 13: 33,985,478 Y228H probably benign Het
Nrg2 T A 18: 36,032,377 E394V probably benign Het
Oas1e T C 5: 120,787,995 N336S probably benign Het
Olfr1443 T G 19: 12,680,480 V124G probably damaging Het
Olfr548-ps1 T A 7: 102,542,858 H307Q probably benign Het
Olfr641 G T 7: 104,039,915 G40W probably benign Het
Pax4 T C 6: 28,442,514 D305G probably benign Het
Pcdhb16 T A 18: 37,478,132 N48K probably damaging Het
Pcdhb20 G T 18: 37,506,610 E730* probably null Het
Pde4a A T 9: 21,191,377 D119V possibly damaging Het
Pgam1 T C 19: 41,915,710 V82A probably benign Het
Phf11a C T 14: 59,284,324 G133S probably damaging Het
Phlpp1 TGCGCGCGCGC TGCGCGCGC 1: 106,172,792 probably null Het
Piwil1 T C 5: 128,749,850 V558A probably damaging Het
Prpf40b T C 15: 99,304,438 V59A unknown Het
Psd4 T A 2: 24,396,689 S353T probably benign Het
Rnf219 G T 14: 104,479,245 S564* probably null Het
Ryr2 A T 13: 11,603,698 L3877H probably damaging Het
S100a2 T C 3: 90,591,309 V39A possibly damaging Het
Tanc2 T A 11: 105,923,222 S1831T probably damaging Het
Zfhx4 A G 3: 5,400,494 K1904R probably damaging Het
Zfp141 A G 7: 42,475,057 C664R probably damaging Het
Other mutations in AI987944
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03350:AI987944 APN 7 41393237 utr 5 prime probably benign
G1citation:AI987944 UTSW 7 41374808 missense probably damaging 1.00
R0744:AI987944 UTSW 7 41376859 missense probably damaging 1.00
R1083:AI987944 UTSW 7 41375339 missense probably benign 0.09
R1480:AI987944 UTSW 7 41374919 missense probably benign 0.00
R1485:AI987944 UTSW 7 41374530 nonsense probably null
R1491:AI987944 UTSW 7 41374348 nonsense probably null
R1662:AI987944 UTSW 7 41374449 missense possibly damaging 0.79
R1892:AI987944 UTSW 7 41374596 missense probably damaging 1.00
R1906:AI987944 UTSW 7 41375126 missense probably benign 0.02
R2037:AI987944 UTSW 7 41374391 missense probably benign 0.04
R2092:AI987944 UTSW 7 41374617 missense possibly damaging 0.58
R2202:AI987944 UTSW 7 41374526 missense probably damaging 0.98
R5070:AI987944 UTSW 7 41375324 missense probably benign 0.23
R5421:AI987944 UTSW 7 41374776 missense probably benign 0.02
R5531:AI987944 UTSW 7 41374390 nonsense probably null
R6822:AI987944 UTSW 7 41374808 missense probably damaging 1.00
R7039:AI987944 UTSW 7 41374456 missense probably benign
R8228:AI987944 UTSW 7 41376836 missense probably damaging 1.00
R8342:AI987944 UTSW 7 41374886 missense probably benign 0.01
R8826:AI987944 UTSW 7 41375203 missense possibly damaging 0.95
R9583:AI987944 UTSW 7 41374513 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACTGTGAACTGCAAAGGCT -3'
(R):5'- TGCAGTAAAGCTCTCACATGTTT -3'

Sequencing Primer
(F):5'- CTGTGAACTGCAAAGGCTTTACC -3'
(R):5'- TATCGCAGTCATCCTCAGAATCATG -3'
Posted On 2020-06-30