Incidental Mutation 'R8133:Ebf3'
ID632118
Institutional Source Beutler Lab
Gene Symbol Ebf3
Ensembl Gene ENSMUSG00000010476
Gene Nameearly B cell factor 3
SynonymsOlf-1/EBF-like 2, O/E-2, 3110018A08Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8133 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location137193673-137314445 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 137313143 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 102 (E102G)
Ref Sequence ENSEMBL: ENSMUSP00000147829 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033378] [ENSMUST00000106118] [ENSMUST00000168203] [ENSMUST00000169486] [ENSMUST00000210774]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033378
AA Change: E102G

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000033378
Gene: ENSMUSG00000010476
AA Change: E102G

DomainStartEndE-ValueType
low complexity region 94 106 N/A INTRINSIC
IPT 253 337 2.09e-7 SMART
HLH 338 387 1.43e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106118
AA Change: E102G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000101724
Gene: ENSMUSG00000010476
AA Change: E102G

DomainStartEndE-ValueType
Pfam:COE1_DBD 17 247 2.6e-151 PFAM
IPT 262 346 2.09e-7 SMART
HLH 347 396 1.43e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168203
AA Change: E102G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000130334
Gene: ENSMUSG00000010476
AA Change: E102G

DomainStartEndE-ValueType
low complexity region 94 106 N/A INTRINSIC
IPT 253 337 2.09e-7 SMART
HLH 338 387 1.43e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169486
AA Change: E102G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000132563
Gene: ENSMUSG00000010476
AA Change: E102G

DomainStartEndE-ValueType
low complexity region 94 106 N/A INTRINSIC
IPT 253 337 2.09e-7 SMART
HLH 338 387 1.43e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000210774
AA Change: E102G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.9%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the early B-cell factor (EBF) family of DNA binding transcription factors. EBF proteins are involved in B-cell differentiation, bone development and neurogenesis, and may also function as tumor suppressors. The encoded protein inhibits cell survival through the regulation of genes involved in cell cycle arrest and apoptosis, and aberrant methylation or deletion of this gene may play a role in multiple malignancies including glioblastoma multiforme and gastric carcinoma. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous mutant mice die perinatally and exhibit impaired olfactory neuron projection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A T 11: 110,127,463 S1110R possibly damaging Het
Adam15 C T 3: 89,347,206 R123Q probably benign Het
AI987944 A G 7: 41,375,065 probably null Het
Ankrd31 T C 13: 96,866,495 probably null Het
Arfgef3 C A 10: 18,611,203 probably null Het
Atp6v0c C T 17: 24,164,579 S98N possibly damaging Het
Camsap1 T C 2: 25,934,297 N1417S probably damaging Het
Cct7 T C 6: 85,461,063 S96P probably damaging Het
Cd38 C A 5: 43,901,448 L135M probably damaging Het
Cib4 T C 5: 30,534,218 D53G probably benign Het
Cntn6 T A 6: 104,728,337 S244T probably benign Het
Cubn G T 2: 13,388,848 D1447E probably damaging Het
Elmo1 T A 13: 20,373,086 V399E probably damaging Het
Etl4 A G 2: 20,806,271 E1423G possibly damaging Het
Glis3 A G 19: 28,350,006 S669P probably benign Het
Gm609 T C 16: 45,443,941 T85A probably benign Het
Hipk1 T C 3: 103,753,394 T742A possibly damaging Het
Igdcc4 C A 9: 65,131,741 T890N possibly damaging Het
Jcad C T 18: 4,649,384 T85I probably benign Het
Kmt2d T C 15: 98,864,942 K316E probably damaging Het
Lrig1 T C 6: 94,611,629 D513G possibly damaging Het
Lrrn4 T C 2: 132,878,014 N289D probably damaging Het
Mcf2l A G 8: 13,011,487 M829V probably damaging Het
Mib2 C T 4: 155,657,001 R495H probably benign Het
Nqo2 T C 13: 33,985,478 Y228H probably benign Het
Nrg2 T A 18: 36,032,377 E394V probably benign Het
Oas1e T C 5: 120,787,995 N336S probably benign Het
Olfr1443 T G 19: 12,680,480 V124G probably damaging Het
Olfr641 G T 7: 104,039,915 G40W probably benign Het
Pax4 T C 6: 28,442,514 D305G probably benign Het
Pcdhb16 T A 18: 37,478,132 N48K probably damaging Het
Pcdhb20 G T 18: 37,506,610 E730* probably null Het
Pde4a A T 9: 21,191,377 D119V possibly damaging Het
Pgam1 T C 19: 41,915,710 V82A probably benign Het
Phf11a C T 14: 59,284,324 G133S probably damaging Het
Phlpp1 TGCGCGCGCGC TGCGCGCGC 1: 106,172,792 probably null Het
Piwil1 T C 5: 128,749,850 V558A probably damaging Het
Prpf40b T C 15: 99,304,438 V59A unknown Het
Psd4 T A 2: 24,396,689 S353T probably benign Het
Rnf219 G T 14: 104,479,245 S564* probably null Het
Ryr2 A T 13: 11,603,698 L3877H probably damaging Het
S100a2 T C 3: 90,591,309 V39A possibly damaging Het
Tanc2 T A 11: 105,923,222 S1831T probably damaging Het
Zfhx4 A G 3: 5,400,494 K1904R probably damaging Het
Zfp141 A G 7: 42,475,057 C664R probably damaging Het
Other mutations in Ebf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Ebf3 APN 7 137225896 splice site probably benign
IGL01938:Ebf3 APN 7 137309318 missense probably damaging 1.00
IGL02076:Ebf3 APN 7 137231301 missense possibly damaging 0.61
IGL02260:Ebf3 APN 7 137206190 missense probably damaging 1.00
IGL02303:Ebf3 APN 7 137309365 missense probably benign 0.01
IGL02828:Ebf3 APN 7 137307518 missense probably damaging 0.98
IGL03211:Ebf3 APN 7 137231304 missense probably benign 0.21
R0885:Ebf3 UTSW 7 137225884 missense probably benign 0.10
R0962:Ebf3 UTSW 7 137225203 missense probably damaging 0.99
R1166:Ebf3 UTSW 7 137313167 splice site probably benign
R1255:Ebf3 UTSW 7 137225212 missense probably benign 0.35
R1804:Ebf3 UTSW 7 137200521 missense possibly damaging 0.89
R4298:Ebf3 UTSW 7 137225229 missense possibly damaging 0.95
R4393:Ebf3 UTSW 7 137225157 missense probably damaging 0.99
R5061:Ebf3 UTSW 7 137313559 missense possibly damaging 0.57
R5880:Ebf3 UTSW 7 137198638 missense probably benign 0.04
R6024:Ebf3 UTSW 7 137200535 missense probably damaging 1.00
R6109:Ebf3 UTSW 7 137206226 missense probably damaging 1.00
R6634:Ebf3 UTSW 7 137201160 missense probably damaging 0.99
R6958:Ebf3 UTSW 7 137199265 missense possibly damaging 0.66
R6997:Ebf3 UTSW 7 137225265 missense probably damaging 0.97
R7578:Ebf3 UTSW 7 137313532 missense probably damaging 1.00
R7771:Ebf3 UTSW 7 137309363 missense probably damaging 1.00
R8185:Ebf3 UTSW 7 137225878 missense possibly damaging 0.87
RF022:Ebf3 UTSW 7 137313942 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TCATGTGAAGTGCCATCGACTTATC -3'
(R):5'- CTTGCGGCAGGAAAAGTGAC -3'

Sequencing Primer
(F):5'- CCTTCTATGCCATGAGAAGATTTCG -3'
(R):5'- GTGACATCACCGCGTAGCTG -3'
Posted On2020-06-30