Incidental Mutation 'R0011:Cops4'
ID63212
Institutional Source Beutler Lab
Gene Symbol Cops4
Ensembl Gene ENSMUSG00000035297
Gene NameCOP9 signalosome subunit 4
SynonymsD5Ertd774e, COP9 complex S4
MMRRC Submission 038306-MU
Accession Numbers

Genbank: NM_012001; MGI: 1349414

Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R0011 (G1)
Quality Score164
Status Not validated
Chromosome5
Chromosomal Location100518309-100547803 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 100527981 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 28 (Q28K)
Ref Sequence ENSEMBL: ENSMUSP00000048416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045993] [ENSMUST00000123069] [ENSMUST00000123492] [ENSMUST00000146476] [ENSMUST00000151414]
PDB Structure
Solution structure of the PCI domain [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000045993
AA Change: Q28K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000048416
Gene: ENSMUSG00000035297
AA Change: Q28K

DomainStartEndE-ValueType
PINT 295 377 2.09e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123069
Predicted Effect probably benign
Transcript: ENSMUST00000123492
SMART Domains Protein: ENSMUSP00000119737
Gene: ENSMUSG00000035297

DomainStartEndE-ValueType
Pfam:PCI 179 251 7.2e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123559
Predicted Effect probably benign
Transcript: ENSMUST00000146476
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147729
Predicted Effect probably benign
Transcript: ENSMUST00000151414
Meta Mutation Damage Score 0.0610 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of eight subunits composing COP9 signalosome, a highly conserved protein complex that functions as an important regulator in multiple signaling pathways. The structure and function of COP9 signalosome is similar to that of the 19S regulatory particle of 26S proteasome. COP9 signalosome has been shown to interact with SCF-type E3 ubiquitin ligases and act as a positive regulator of E3 ubiquitin ligases. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Allele List at MGI

All alleles(8) : Targeted, other(2) Gene trapped(6)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik T A 7: 131,229,993 L389Q probably damaging Het
A930011G23Rik T C 5: 99,232,354 Y344C probably damaging Het
Alox15 A G 11: 70,349,596 V253A possibly damaging Het
Ank3 A G 10: 69,979,451 probably benign Het
Art3 T A 5: 92,403,612 Y17N probably damaging Het
Asic3 C T 5: 24,417,492 probably benign Het
Bach2 G T 4: 32,244,655 probably benign Het
Brip1 C A 11: 86,186,998 K201N possibly damaging Het
Casc1 T A 6: 145,179,055 M515L probably damaging Het
Ccdc88a T C 11: 29,374,364 F6S probably damaging Het
Celsr2 A G 3: 108,413,402 I698T probably benign Het
Cenpf A G 1: 189,650,706 S2664P probably benign Het
Cfap54 A T 10: 93,065,225 C156S probably damaging Het
Cyb5a T A 18: 84,877,822 probably benign Het
Diaph3 A T 14: 86,866,408 C847S probably damaging Het
Dnah3 T C 7: 120,019,701 K1648R probably damaging Het
Emilin2 C T 17: 71,273,868 G621E probably benign Het
Enpp1 T A 10: 24,670,002 K228* probably null Het
Epg5 T C 18: 77,948,483 C132R probably benign Het
Epha7 G A 4: 28,962,564 D961N probably benign Het
G6pc2 C A 2: 69,226,565 probably benign Het
Gm7361 C T 5: 26,258,878 probably benign Het
Grin2c T C 11: 115,255,750 Y476C probably damaging Het
Hnrnpul1 T G 7: 25,742,915 probably benign Het
Igf2bp1 T C 11: 96,005,584 D17G probably damaging Het
Insrr T C 3: 87,809,616 C688R possibly damaging Het
Itgb2l T C 16: 96,427,661 probably benign Het
Kidins220 T A 12: 24,999,352 V322E probably damaging Het
Klk1 C T 7: 44,229,535 T149I probably benign Het
Mbd3l1 A G 9: 18,484,567 probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mrc1 T C 2: 14,261,337 probably null Het
Mtr T C 13: 12,238,052 probably benign Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Npy4r C T 14: 34,146,723 V203M probably damaging Het
Olfr965 T A 9: 39,719,627 N133K probably benign Het
Pik3r4 C A 9: 105,644,637 T134K probably benign Het
Rdh19 T A 10: 127,856,911 L149Q probably damaging Het
Sema3e C T 5: 14,144,011 R85* probably null Het
Shtn1 A G 19: 59,032,218 S191P possibly damaging Het
Slc39a11 A T 11: 113,247,833 F279L probably benign Het
Slc4a1 T C 11: 102,357,110 K353E possibly damaging Het
Slc6a18 A T 13: 73,665,619 M515K possibly damaging Het
Snapc4 A G 2: 26,364,813 I1225T probably benign Het
Spidr A T 16: 15,966,603 W534R probably benign Het
Tmem202 T A 9: 59,524,801 N81I probably benign Het
Tnfrsf1b T G 4: 145,222,966 R297S possibly damaging Het
Trim55 A G 3: 19,670,999 T227A probably benign Het
Trim58 A T 11: 58,643,120 T167S probably benign Het
Trp53i11 A T 2: 93,199,353 probably benign Het
Ttn T C 2: 76,810,355 H5356R probably damaging Het
Tyrp1 C T 4: 80,840,793 T301I probably damaging Het
Wdr17 A T 8: 54,672,501 I448K possibly damaging Het
Wscd1 T C 11: 71,788,828 V509A probably damaging Het
Zfp251 A G 15: 76,854,554 V108A probably benign Het
Other mutations in Cops4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00788:Cops4 APN 5 100533555 missense probably damaging 1.00
IGL02152:Cops4 APN 5 100533590 missense probably benign 0.20
R0011:Cops4 UTSW 5 100527981 missense probably benign
R0326:Cops4 UTSW 5 100528542 missense probably damaging 0.99
R0494:Cops4 UTSW 5 100528662 missense probably damaging 0.97
R0639:Cops4 UTSW 5 100537460 missense possibly damaging 0.48
R1162:Cops4 UTSW 5 100530157 splice site probably benign
R1400:Cops4 UTSW 5 100533546 missense probably damaging 1.00
R4209:Cops4 UTSW 5 100547486 unclassified probably benign
R4943:Cops4 UTSW 5 100547426 missense probably benign 0.00
R5244:Cops4 UTSW 5 100533375 missense probably benign 0.00
R5350:Cops4 UTSW 5 100518539 missense possibly damaging 0.81
R5855:Cops4 UTSW 5 100547414 missense probably benign
R6010:Cops4 UTSW 5 100543910 missense possibly damaging 0.63
R6026:Cops4 UTSW 5 100542328 unclassified probably benign
R7390:Cops4 UTSW 5 100543875 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGTTCAGttctcttgctgctagaaaa -3'
(R):5'- AGGCAAAGCACAGAGCATCTGTATAAA -3'

Sequencing Primer
(F):5'- gaaaataccctgacaagccac -3'
(R):5'- CCAACTATGAGTGGCTAAAAGC -3'
Posted On2013-07-30