Incidental Mutation 'R8133:Pde4a'
ID632120
Institutional Source Beutler Lab
Gene Symbol Pde4a
Ensembl Gene ENSMUSG00000032177
Gene Namephosphodiesterase 4A, cAMP specific
SynonymsDpde2, dunce, D9Ertd60e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.241) question?
Stock #R8133 (G1)
Quality Score161.009
Status Validated
Chromosome9
Chromosomal Location21165714-21213248 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 21191377 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 119 (D119V)
Ref Sequence ENSEMBL: ENSMUSP00000037025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039413] [ENSMUST00000115458]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039413
AA Change: D119V

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000037025
Gene: ENSMUSG00000032177
AA Change: D119V

DomainStartEndE-ValueType
low complexity region 35 46 N/A INTRINSIC
low complexity region 92 102 N/A INTRINSIC
low complexity region 296 321 N/A INTRINSIC
HDc 416 591 7.12e-5 SMART
low complexity region 696 709 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115458
AA Change: D62V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111118
Gene: ENSMUSG00000032177
AA Change: D62V

DomainStartEndE-ValueType
low complexity region 5 20 N/A INTRINSIC
low complexity region 239 264 N/A INTRINSIC
HDc 359 534 7.12e-5 SMART
low complexity region 639 652 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.9%
  • 20x: 96.3%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase (PDE) family, and PDE4 subfamily. This PDE hydrolyzes the second messenger, cAMP, which is a regulator and mediator of a number of cellular responses to extracellular signals. Thus, by regulating the cellular concentration of cAMP, this protein plays a key role in many important physiological processes. Alternatively spliced transcript variants encoding different isoforms have been described for this gene.[provided by RefSeq, Jul 2011]
PHENOTYPE: Homozygous null mice have a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A T 11: 110,127,463 S1110R possibly damaging Het
Adam15 C T 3: 89,347,206 R123Q probably benign Het
AI987944 A G 7: 41,375,065 probably null Het
Ankrd31 T C 13: 96,866,495 probably null Het
Arfgef3 C A 10: 18,611,203 probably null Het
Atp6v0c C T 17: 24,164,579 S98N possibly damaging Het
Camsap1 T C 2: 25,934,297 N1417S probably damaging Het
Cct7 T C 6: 85,461,063 S96P probably damaging Het
Cd38 C A 5: 43,901,448 L135M probably damaging Het
Cib4 T C 5: 30,534,218 D53G probably benign Het
Cntn6 T A 6: 104,728,337 S244T probably benign Het
Cubn G T 2: 13,388,848 D1447E probably damaging Het
Ebf3 T C 7: 137,313,143 E102G probably damaging Het
Elmo1 T A 13: 20,373,086 V399E probably damaging Het
Etl4 A G 2: 20,806,271 E1423G possibly damaging Het
Glis3 A G 19: 28,350,006 S669P probably benign Het
Gm609 T C 16: 45,443,941 T85A probably benign Het
Hipk1 T C 3: 103,753,394 T742A possibly damaging Het
Igdcc4 C A 9: 65,131,741 T890N possibly damaging Het
Jcad C T 18: 4,649,384 T85I probably benign Het
Kmt2d T C 15: 98,864,942 K316E probably damaging Het
Lrig1 T C 6: 94,611,629 D513G possibly damaging Het
Lrrn4 T C 2: 132,878,014 N289D probably damaging Het
Mcf2l A G 8: 13,011,487 M829V probably damaging Het
Mib2 C T 4: 155,657,001 R495H probably benign Het
Nqo2 T C 13: 33,985,478 Y228H probably benign Het
Nrg2 T A 18: 36,032,377 E394V probably benign Het
Oas1e T C 5: 120,787,995 N336S probably benign Het
Olfr1443 T G 19: 12,680,480 V124G probably damaging Het
Olfr548-ps1 T A 7: 102,542,858 H307Q probably benign Het
Olfr641 G T 7: 104,039,915 G40W probably benign Het
Pax4 T C 6: 28,442,514 D305G probably benign Het
Pcdhb16 T A 18: 37,478,132 N48K probably damaging Het
Pcdhb20 G T 18: 37,506,610 E730* probably null Het
Pgam1 T C 19: 41,915,710 V82A probably benign Het
Phf11a C T 14: 59,284,324 G133S probably damaging Het
Phlpp1 TGCGCGCGCGC TGCGCGCGC 1: 106,172,792 probably null Het
Piwil1 T C 5: 128,749,850 V558A probably damaging Het
Prpf40b T C 15: 99,304,438 V59A unknown Het
Psd4 T A 2: 24,396,689 S353T probably benign Het
Rnf219 G T 14: 104,479,245 S564* probably null Het
Ryr2 A T 13: 11,603,698 L3877H probably damaging Het
S100a2 T C 3: 90,591,309 V39A possibly damaging Het
Tanc2 T A 11: 105,923,222 S1831T probably damaging Het
Zfhx4 A G 3: 5,400,494 K1904R probably damaging Het
Zfp141 A G 7: 42,475,057 C664R probably damaging Het
Other mutations in Pde4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Pde4a APN 9 21211061 missense probably benign 0.01
IGL01330:Pde4a APN 9 21192438 splice site probably benign
IGL01403:Pde4a APN 9 21205116 missense probably damaging 1.00
IGL01610:Pde4a APN 9 21211350 utr 3 prime probably benign
IGL02010:Pde4a APN 9 21203554 critical splice donor site probably null
IGL02296:Pde4a APN 9 21192569 missense possibly damaging 0.94
IGL02637:Pde4a APN 9 21201332 missense probably damaging 0.97
PIT4696001:Pde4a UTSW 9 21211001 missense probably benign
R0032:Pde4a UTSW 9 21201432 splice site probably benign
R0032:Pde4a UTSW 9 21201432 splice site probably benign
R0257:Pde4a UTSW 9 21192421 missense probably damaging 1.00
R0504:Pde4a UTSW 9 21204403 missense probably damaging 1.00
R1437:Pde4a UTSW 9 21192592 critical splice donor site probably null
R1524:Pde4a UTSW 9 21201247 missense probably damaging 0.98
R1750:Pde4a UTSW 9 21203232 missense probably damaging 1.00
R2239:Pde4a UTSW 9 21211268 missense probably damaging 1.00
R2905:Pde4a UTSW 9 21201349 missense probably benign 0.01
R2991:Pde4a UTSW 9 21203243 missense probably damaging 0.96
R3972:Pde4a UTSW 9 21206217 missense probably damaging 1.00
R4826:Pde4a UTSW 9 21192380 splice site probably null
R4922:Pde4a UTSW 9 21210713 missense probably damaging 1.00
R5195:Pde4a UTSW 9 21204333 missense possibly damaging 0.70
R5208:Pde4a UTSW 9 21203558 splice site probably null
R5552:Pde4a UTSW 9 21201386 missense probably damaging 1.00
R5713:Pde4a UTSW 9 21203517 missense probably damaging 1.00
R6722:Pde4a UTSW 9 21211225 missense probably damaging 1.00
R6792:Pde4a UTSW 9 21192590 missense probably benign 0.03
R6861:Pde4a UTSW 9 21205301 missense probably damaging 1.00
R6901:Pde4a UTSW 9 21204970 missense probably benign 0.37
R7300:Pde4a UTSW 9 21206322 missense probably damaging 1.00
R7690:Pde4a UTSW 9 21166004 missense probably damaging 1.00
R7798:Pde4a UTSW 9 21198663 missense possibly damaging 0.63
R8073:Pde4a UTSW 9 21210769 missense probably damaging 1.00
R8167:Pde4a UTSW 9 21206173 missense possibly damaging 0.95
R8297:Pde4a UTSW 9 21166108 missense possibly damaging 0.94
R8348:Pde4a UTSW 9 21206238 missense probably benign 0.35
R8448:Pde4a UTSW 9 21206238 missense probably benign 0.35
X0027:Pde4a UTSW 9 21198654 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTATGAGTTCGAGGCTAGCC -3'
(R):5'- CCCTTCAGTGGGGAGGATAATG -3'

Sequencing Primer
(F):5'- TAGCCCCTCTCTCCCGAAGAATC -3'
(R):5'- TGACCAAACTGGGGGTTCG -3'
Posted On2020-06-30