Mutagenetix > Incidental Mutation

Incidental Mutation 'R8133:Arfgef3'

632122

Institutional Source

Beutler Lab

Gene Symbol

Arfgef3

Ensembl Gene

ENSMUSG00000019852

Gene Name

ARFGEF family member 3

Synonyms

B930094H20Rik, D10Bwg1379e, BIG3

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.147) question?

Stock #

R8133 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

18581839-18743949 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

C to A at 18611203 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000149210 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019999] [ENSMUST00000215836]

AlphaFold

Q3UGY8

Predicted Effect

probably null
Transcript: ENSMUST00000019999

SMART Domains

Protein: ENSMUSP00000019999
Gene: ENSMUSG00000019852

Domain	Start	End	E-Value	Type
Pfam:DCB	1	170	7.1e-15	PFAM
low complexity region	236	245	N/A	INTRINSIC
low complexity region	276	295	N/A	INTRINSIC
low complexity region	452	462	N/A	INTRINSIC
Sec7	582	794	6e-54	SMART
Blast:Sec7	798	873	3e-20	BLAST
low complexity region	927	940	N/A	INTRINSIC
Pfam:DUF1981	1237	1312	1.9e-14	PFAM
low complexity region	1641	1652	N/A	INTRINSIC
low complexity region	1710	1723	N/A	INTRINSIC
low complexity region	1838	1856	N/A	INTRINSIC
low complexity region	2088	2099	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000215836

Meta Mutation Damage Score

0.9496

Coding Region Coverage

1x: 99.8%
3x: 99.6%
10x: 98.9%
20x: 96.3%

Validation Efficiency

98% (48/49)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased insulin granule biogenesis and insulin secretion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca9	A	T	11: 110,127,463	S1110R	possibly damaging	Het
Adam15	C	T	3: 89,347,206	R123Q	probably benign	Het
AI987944	A	G	7: 41,375,065		probably null	Het
Ankrd31	T	C	13: 96,866,495		probably null	Het
Atp6v0c	C	T	17: 24,164,579	S98N	possibly damaging	Het
Camsap1	T	C	2: 25,934,297	N1417S	probably damaging	Het
Cct7	T	C	6: 85,461,063	S96P	probably damaging	Het
Cd38	C	A	5: 43,901,448	L135M	probably damaging	Het
Cib4	T	C	5: 30,534,218	D53G	probably benign	Het
Cntn6	T	A	6: 104,728,337	S244T	probably benign	Het
Cubn	G	T	2: 13,388,848	D1447E	probably damaging	Het
Ebf3	T	C	7: 137,313,143	E102G	probably damaging	Het
Elmo1	T	A	13: 20,373,086	V399E	probably damaging	Het
Etl4	A	G	2: 20,806,271	E1423G	possibly damaging	Het
Glis3	A	G	19: 28,350,006	S669P	probably benign	Het
Gm609	T	C	16: 45,443,941	T85A	probably benign	Het
Hipk1	T	C	3: 103,753,394	T742A	possibly damaging	Het
Igdcc4	C	A	9: 65,131,741	T890N	possibly damaging	Het
Jcad	C	T	18: 4,649,384	T85I	probably benign	Het
Kmt2d	T	C	15: 98,864,942	K316E	probably damaging	Het
Lrig1	T	C	6: 94,611,629	D513G	possibly damaging	Het
Lrrn4	T	C	2: 132,878,014	N289D	probably damaging	Het
Mcf2l	A	G	8: 13,011,487	M829V	probably damaging	Het
Mib2	C	T	4: 155,657,001	R495H	probably benign	Het
Nqo2	T	C	13: 33,985,478	Y228H	probably benign	Het
Nrg2	T	A	18: 36,032,377	E394V	probably benign	Het
Oas1e	T	C	5: 120,787,995	N336S	probably benign	Het
Olfr1443	T	G	19: 12,680,480	V124G	probably damaging	Het
Olfr548-ps1	T	A	7: 102,542,858	H307Q	probably benign	Het
Olfr641	G	T	7: 104,039,915	G40W	probably benign	Het
Pax4	T	C	6: 28,442,514	D305G	probably benign	Het
Pcdhb16	T	A	18: 37,478,132	N48K	probably damaging	Het
Pcdhb20	G	T	18: 37,506,610	E730*	probably null	Het
Pde4a	A	T	9: 21,191,377	D119V	possibly damaging	Het
Pgam1	T	C	19: 41,915,710	V82A	probably benign	Het
Phf11a	C	T	14: 59,284,324	G133S	probably damaging	Het
Phlpp1	TGCGCGCGCGC	TGCGCGCGC	1: 106,172,792		probably null	Het
Piwil1	T	C	5: 128,749,850	V558A	probably damaging	Het
Prpf40b	T	C	15: 99,304,438	V59A	unknown	Het
Psd4	T	A	2: 24,396,689	S353T	probably benign	Het
Rnf219	G	T	14: 104,479,245	S564*	probably null	Het
Ryr2	A	T	13: 11,603,698	L3877H	probably damaging	Het
S100a2	T	C	3: 90,591,309	V39A	possibly damaging	Het
Tanc2	T	A	11: 105,923,222	S1831T	probably damaging	Het
Zfhx4	A	G	3: 5,400,494	K1904R	probably damaging	Het
Zfp141	A	G	7: 42,475,057	C664R	probably damaging	Het

Other mutations in Arfgef3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00769:Arfgef3	APN	10	18660604	missense	probably benign	0.03
IGL00835:Arfgef3	APN	10	18661358	missense	probably benign
IGL00961:Arfgef3	APN	10	18611237	missense	probably damaging	1.00
IGL01400:Arfgef3	APN	10	18652706	missense	probably damaging	1.00
IGL01501:Arfgef3	APN	10	18600560	missense	possibly damaging	0.93
IGL01595:Arfgef3	APN	10	18594912	missense	possibly damaging	0.93
IGL01695:Arfgef3	APN	10	18603419	missense	probably benign	0.00
IGL01774:Arfgef3	APN	10	18743615	missense	possibly damaging	0.94
IGL02348:Arfgef3	APN	10	18591347	missense	probably benign	0.04
IGL02371:Arfgef3	APN	10	18646539	missense	probably benign
IGL02400:Arfgef3	APN	10	18646257	missense	probably damaging	1.00
IGL02630:Arfgef3	APN	10	18661392	splice site	probably benign
IGL02815:Arfgef3	APN	10	18652551	missense	probably damaging	1.00
IGL03178:Arfgef3	APN	10	18613225	missense	probably damaging	1.00
IGL03182:Arfgef3	APN	10	18600544	missense	probably damaging	1.00
IGL03267:Arfgef3	APN	10	18591882	missense	probably damaging	1.00
IGL03294:Arfgef3	APN	10	18664912	missense	probably damaging	0.97
IGL03410:Arfgef3	APN	10	18600490	missense	probably damaging	1.00
Bow-wow	UTSW	10	18646730	nonsense	probably null
R0098:Arfgef3	UTSW	10	18589642	missense	probably damaging	1.00
R0098:Arfgef3	UTSW	10	18589642	missense	probably damaging	1.00
R0141:Arfgef3	UTSW	10	18597407	missense	probably damaging	1.00
R0164:Arfgef3	UTSW	10	18647915	missense	possibly damaging	0.77
R0164:Arfgef3	UTSW	10	18647915	missense	possibly damaging	0.77
R0241:Arfgef3	UTSW	10	18599214	missense	probably damaging	1.00
R0334:Arfgef3	UTSW	10	18592281	missense	probably damaging	0.98
R0352:Arfgef3	UTSW	10	18661387	missense	probably benign	0.17
R0415:Arfgef3	UTSW	10	18613127	splice site	probably benign
R0417:Arfgef3	UTSW	10	18603511	missense	probably damaging	1.00
R0442:Arfgef3	UTSW	10	18677815	splice site	probably benign
R0507:Arfgef3	UTSW	10	18591621	missense	probably damaging	1.00
R0573:Arfgef3	UTSW	10	18599288	missense	probably damaging	1.00
R0582:Arfgef3	UTSW	10	18611290	missense	probably damaging	1.00
R0609:Arfgef3	UTSW	10	18597431	missense	probably benign	0.31
R0826:Arfgef3	UTSW	10	18589666	missense	probably damaging	0.98
R0919:Arfgef3	UTSW	10	18589735	missense	possibly damaging	0.89
R0980:Arfgef3	UTSW	10	18592118	missense	possibly damaging	0.82
R1027:Arfgef3	UTSW	10	18591375	missense	probably benign	0.02
R1140:Arfgef3	UTSW	10	18597348	missense	possibly damaging	0.77
R1491:Arfgef3	UTSW	10	18646554	missense	probably damaging	1.00
R1493:Arfgef3	UTSW	10	18630879	missense	probably damaging	0.96
R1529:Arfgef3	UTSW	10	18613222	nonsense	probably null
R1564:Arfgef3	UTSW	10	18591704	missense	probably damaging	1.00
R1654:Arfgef3	UTSW	10	18625148	missense	probably null	0.15
R1868:Arfgef3	UTSW	10	18661387	missense	probably benign	0.17
R1876:Arfgef3	UTSW	10	18597356	missense	probably damaging	1.00
R1908:Arfgef3	UTSW	10	18652763	missense	possibly damaging	0.80
R2211:Arfgef3	UTSW	10	18592245	missense	possibly damaging	0.54
R2316:Arfgef3	UTSW	10	18616953	missense	probably benign	0.19
R2393:Arfgef3	UTSW	10	18597787	missense	possibly damaging	0.88
R2407:Arfgef3	UTSW	10	18677866	missense	possibly damaging	0.63
R3076:Arfgef3	UTSW	10	18603530	missense	probably damaging	0.99
R3077:Arfgef3	UTSW	10	18603530	missense	probably damaging	0.99
R3963:Arfgef3	UTSW	10	18592277	missense	probably damaging	1.00
R4201:Arfgef3	UTSW	10	18619782	missense	probably benign	0.01
R4241:Arfgef3	UTSW	10	18625164	missense	probably damaging	1.00
R4244:Arfgef3	UTSW	10	18630420	missense	probably damaging	1.00
R4395:Arfgef3	UTSW	10	18597709	missense	probably damaging	1.00
R4455:Arfgef3	UTSW	10	18607675	missense	probably benign	0.18
R4480:Arfgef3	UTSW	10	18600600	missense	probably damaging	1.00
R4499:Arfgef3	UTSW	10	18608343	missense	possibly damaging	0.95
R4589:Arfgef3	UTSW	10	18646199	missense	probably damaging	1.00
R4635:Arfgef3	UTSW	10	18634855	missense	probably damaging	1.00
R4776:Arfgef3	UTSW	10	18654247	missense	probably benign
R4801:Arfgef3	UTSW	10	18591906	missense	probably benign	0.00
R4802:Arfgef3	UTSW	10	18591906	missense	probably benign	0.00
R4807:Arfgef3	UTSW	10	18646637	missense	probably benign
R4828:Arfgef3	UTSW	10	18652693	missense	probably damaging	0.99
R4861:Arfgef3	UTSW	10	18607731	missense	probably benign	0.01
R4861:Arfgef3	UTSW	10	18607731	missense	probably benign	0.01
R4917:Arfgef3	UTSW	10	18616890	missense	probably damaging	0.99
R4918:Arfgef3	UTSW	10	18616890	missense	probably damaging	0.99
R4922:Arfgef3	UTSW	10	18592186	missense	probably damaging	0.97
R4929:Arfgef3	UTSW	10	18630851	missense	probably benign	0.00
R4937:Arfgef3	UTSW	10	18589706	missense	probably damaging	0.98
R5290:Arfgef3	UTSW	10	18600460	missense	probably damaging	1.00
R5410:Arfgef3	UTSW	10	18611237	missense	probably damaging	0.99
R5807:Arfgef3	UTSW	10	18647798	splice site	probably null
R5832:Arfgef3	UTSW	10	18630420	missense	probably damaging	1.00
R5887:Arfgef3	UTSW	10	18607665	nonsense	probably null
R6272:Arfgef3	UTSW	10	18646963	missense	probably benign	0.00
R6302:Arfgef3	UTSW	10	18652841	missense	probably damaging	0.97
R6397:Arfgef3	UTSW	10	18607665	nonsense	probably null
R6495:Arfgef3	UTSW	10	18611202	critical splice donor site	probably null
R6707:Arfgef3	UTSW	10	18621155	missense	probably benign	0.11
R6814:Arfgef3	UTSW	10	18595019	missense	probably damaging	1.00
R6830:Arfgef3	UTSW	10	18664889	critical splice donor site	probably null
R6870:Arfgef3	UTSW	10	18646730	nonsense	probably null
R6941:Arfgef3	UTSW	10	18625455	missense	possibly damaging	0.66
R7094:Arfgef3	UTSW	10	18646439	missense	probably damaging	1.00
R7179:Arfgef3	UTSW	10	18599267	missense	probably damaging	1.00
R7204:Arfgef3	UTSW	10	18646462	missense	probably damaging	1.00
R7247:Arfgef3	UTSW	10	18625391	missense	probably benign	0.00
R7249:Arfgef3	UTSW	10	18630835	missense	possibly damaging	0.62
R7318:Arfgef3	UTSW	10	18630463	missense	possibly damaging	0.89
R7391:Arfgef3	UTSW	10	18646259	missense	probably benign	0.05
R7527:Arfgef3	UTSW	10	18646629	missense	probably benign
R7618:Arfgef3	UTSW	10	18646281	missense	probably damaging	1.00
R7779:Arfgef3	UTSW	10	18595023	missense	probably damaging	0.99
R7851:Arfgef3	UTSW	10	18592286	missense	probably damaging	1.00
R8112:Arfgef3	UTSW	10	18652631	missense	possibly damaging	0.96
R8242:Arfgef3	UTSW	10	18630076	missense	probably benign	0.25
R8369:Arfgef3	UTSW	10	18589729	missense	probably benign	0.34
R8396:Arfgef3	UTSW	10	18652532	critical splice donor site	probably null
R8553:Arfgef3	UTSW	10	18603530	missense	probably damaging	0.99
R8798:Arfgef3	UTSW	10	18647051	missense	probably damaging	1.00
R8821:Arfgef3	UTSW	10	18652743	missense	possibly damaging	0.95
R8831:Arfgef3	UTSW	10	18652743	missense	possibly damaging	0.95
R8918:Arfgef3	UTSW	10	18635705	missense	probably benign	0.01
R8929:Arfgef3	UTSW	10	18603455	missense	probably damaging	1.00
R9001:Arfgef3	UTSW	10	18646728	missense	probably benign	0.32
R9077:Arfgef3	UTSW	10	18625151	missense	possibly damaging	0.81
R9258:Arfgef3	UTSW	10	18589639	missense	probably damaging	1.00
R9267:Arfgef3	UTSW	10	18599280	missense	probably damaging	1.00
R9358:Arfgef3	UTSW	10	18616880	missense	probably damaging	1.00
R9388:Arfgef3	UTSW	10	18630129	missense	probably benign	0.35
R9389:Arfgef3	UTSW	10	18603523	missense	probably damaging	1.00
R9563:Arfgef3	UTSW	10	18646527	missense	probably damaging	1.00
R9713:Arfgef3	UTSW	10	18652808	missense	probably damaging	1.00
X0026:Arfgef3	UTSW	10	18652626	missense	probably damaging	1.00
Z1176:Arfgef3	UTSW	10	18591437	missense	probably damaging	1.00
Z1176:Arfgef3	UTSW	10	18608358	missense	probably damaging	0.97
Z1176:Arfgef3	UTSW	10	18634852	missense	probably benign	0.26
Z1177:Arfgef3	UTSW	10	18607776	missense	probably damaging	1.00
Z1177:Arfgef3	UTSW	10	18627628	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AATTTGTGGTTAACCCTCCTGC -3'
(R):5'- GAGAGTATTAGCACCCTGAAGG -3'

Sequencing Primer
(F):5'- GCAACCCTAAATATCTTGTTAGACC -3'
(R):5'- TCTTCCCTCAGGAAAAGG -3'

Posted On

2020-06-30