Mutagenetix > Incidental Mutation

Incidental Mutation 'R8133:Nqo2'

632127

Institutional Source

Beutler Lab

Gene Symbol

Nqo2

Ensembl Gene

ENSMUSG00000046949

Gene Name

N-ribosyldihydronicotinamide quinone reductase 2

Synonyms

Nmor2, Ox-2, NRH: quinone oxidoreductase, Ox2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.116) question?

Stock #

R8133 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

33964687-33988443 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 33985478 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 228 (Y228H)

Ref Sequence

ENSEMBL: ENSMUSP00000021843 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021843] [ENSMUST00000058978] [ENSMUST00000076532] [ENSMUST00000166354] [ENSMUST00000167237] [ENSMUST00000168400] [ENSMUST00000171034] [ENSMUST00000220844] [ENSMUST00000222740] [ENSMUST00000223479]

AlphaFold

Q9JI75

Predicted Effect

probably benign
Transcript: ENSMUST00000021843
AA Change: Y228H

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000021843
Gene: ENSMUSG00000046949
AA Change: Y228H

Domain	Start	End	E-Value	Type
Pfam:FMN_red	4	159	5.6e-15	PFAM
Pfam:Flavodoxin_2	4	212	3.5e-55	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000058978
AA Change: Y228H

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000053809
Gene: ENSMUSG00000046949
AA Change: Y228H

Domain	Start	End	E-Value	Type
Pfam:FMN_red	4	158	2e-14	PFAM
Pfam:Flavodoxin_2	4	212	2.6e-55	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000076532

SMART Domains

Protein: ENSMUSP00000075848
Gene: ENSMUSG00000060147

Domain	Start	End	E-Value	Type
SERPIN	13	378	2.84e-179	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000166354

SMART Domains

Protein: ENSMUSP00000126287
Gene: ENSMUSG00000060147

Domain	Start	End	E-Value	Type
Pfam:Serpin	6	66	3.8e-18	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000167237

Predicted Effect

probably benign
Transcript: ENSMUST00000168400

SMART Domains

Protein: ENSMUSP00000126450
Gene: ENSMUSG00000060147

Domain	Start	End	E-Value	Type
Pfam:Serpin	6	120	3.5e-31	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000171034

SMART Domains

Protein: ENSMUSP00000132433
Gene: ENSMUSG00000060147

Domain	Start	End	E-Value	Type
SERPIN	13	228	3.54e-34	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000220844
AA Change: Y184H

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

Predicted Effect

probably benign
Transcript: ENSMUST00000222740
AA Change: Y228H

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

Predicted Effect

probably benign
Transcript: ENSMUST00000223479

Meta Mutation Damage Score

0.0846

Coding Region Coverage

1x: 99.8%
3x: 99.6%
10x: 98.9%
20x: 96.3%

Validation Efficiency

98% (48/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the thioredoxin family of enzymes. It is a cytosolic and ubiquitously expressed flavoprotein that catalyzes the two-electron reduction of quinone substrates and uses dihydronicotinamide riboside as a reducing coenzyme. Mutations in this gene have been associated with neurodegenerative diseases and several cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygouse for disruptions in this gene have an essentially normal phenotype but with abnormalities in WBC counts and increased susceptibility to chemically induced tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca9	A	T	11: 110,127,463	S1110R	possibly damaging	Het
Adam15	C	T	3: 89,347,206	R123Q	probably benign	Het
AI987944	A	G	7: 41,375,065		probably null	Het
Ankrd31	T	C	13: 96,866,495		probably null	Het
Arfgef3	C	A	10: 18,611,203		probably null	Het
Atp6v0c	C	T	17: 24,164,579	S98N	possibly damaging	Het
Camsap1	T	C	2: 25,934,297	N1417S	probably damaging	Het
Cct7	T	C	6: 85,461,063	S96P	probably damaging	Het
Cd38	C	A	5: 43,901,448	L135M	probably damaging	Het
Cib4	T	C	5: 30,534,218	D53G	probably benign	Het
Cntn6	T	A	6: 104,728,337	S244T	probably benign	Het
Cubn	G	T	2: 13,388,848	D1447E	probably damaging	Het
Ebf3	T	C	7: 137,313,143	E102G	probably damaging	Het
Elmo1	T	A	13: 20,373,086	V399E	probably damaging	Het
Etl4	A	G	2: 20,806,271	E1423G	possibly damaging	Het
Glis3	A	G	19: 28,350,006	S669P	probably benign	Het
Gm609	T	C	16: 45,443,941	T85A	probably benign	Het
Hipk1	T	C	3: 103,753,394	T742A	possibly damaging	Het
Igdcc4	C	A	9: 65,131,741	T890N	possibly damaging	Het
Jcad	C	T	18: 4,649,384	T85I	probably benign	Het
Kmt2d	T	C	15: 98,864,942	K316E	probably damaging	Het
Lrig1	T	C	6: 94,611,629	D513G	possibly damaging	Het
Lrrn4	T	C	2: 132,878,014	N289D	probably damaging	Het
Mcf2l	A	G	8: 13,011,487	M829V	probably damaging	Het
Mib2	C	T	4: 155,657,001	R495H	probably benign	Het
Nrg2	T	A	18: 36,032,377	E394V	probably benign	Het
Oas1e	T	C	5: 120,787,995	N336S	probably benign	Het
Olfr1443	T	G	19: 12,680,480	V124G	probably damaging	Het
Olfr548-ps1	T	A	7: 102,542,858	H307Q	probably benign	Het
Olfr641	G	T	7: 104,039,915	G40W	probably benign	Het
Pax4	T	C	6: 28,442,514	D305G	probably benign	Het
Pcdhb16	T	A	18: 37,478,132	N48K	probably damaging	Het
Pcdhb20	G	T	18: 37,506,610	E730*	probably null	Het
Pde4a	A	T	9: 21,191,377	D119V	possibly damaging	Het
Pgam1	T	C	19: 41,915,710	V82A	probably benign	Het
Phf11a	C	T	14: 59,284,324	G133S	probably damaging	Het
Phlpp1	TGCGCGCGCGC	TGCGCGCGC	1: 106,172,792		probably null	Het
Piwil1	T	C	5: 128,749,850	V558A	probably damaging	Het
Prpf40b	T	C	15: 99,304,438	V59A	unknown	Het
Psd4	T	A	2: 24,396,689	S353T	probably benign	Het
Rnf219	G	T	14: 104,479,245	S564*	probably null	Het
Ryr2	A	T	13: 11,603,698	L3877H	probably damaging	Het
S100a2	T	C	3: 90,591,309	V39A	possibly damaging	Het
Tanc2	T	A	11: 105,923,222	S1831T	probably damaging	Het
Zfhx4	A	G	3: 5,400,494	K1904R	probably damaging	Het
Zfp141	A	G	7: 42,475,057	C664R	probably damaging	Het

Other mutations in Nqo2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02135:Nqo2	APN	13	33985343	nonsense	probably null
IGL02884:Nqo2	APN	13	33972361	missense	probably damaging	1.00
R0021:Nqo2	UTSW	13	33981507	missense	probably benign
R0021:Nqo2	UTSW	13	33981507	missense	probably benign
R0848:Nqo2	UTSW	13	33972478	critical splice donor site	probably null
R0853:Nqo2	UTSW	13	33979577	missense	probably benign
R3417:Nqo2	UTSW	13	33979633	missense	probably benign	0.01
R4110:Nqo2	UTSW	13	33979637	missense	probably benign	0.00
R4936:Nqo2	UTSW	13	33981518	missense	probably damaging	1.00
R5861:Nqo2	UTSW	13	33972430	missense	probably damaging	1.00
R6161:Nqo2	UTSW	13	33979651	missense	probably damaging	0.99
R6599:Nqo2	UTSW	13	33979556	missense	probably damaging	1.00
R7909:Nqo2	UTSW	13	33972431	missense	probably damaging	1.00
R8495:Nqo2	UTSW	13	33981494	missense	probably damaging	1.00
R8543:Nqo2	UTSW	13	33985314	critical splice acceptor site	probably null
R9211:Nqo2	UTSW	13	33972416	missense	probably benign	0.08
R9605:Nqo2	UTSW	13	33972378	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- TGGCTTCAGCATGGTACAC -3'
(R):5'- AAGCAATTCCCACTGCCCTG -3'

Sequencing Primer
(F):5'- CACTGCACTTCTGTGGATTTAAAGTC -3'
(R):5'- CAGTGCAACAAGCTGACTTTTG -3'

Posted On

2020-06-30