Incidental Mutation 'R8133:Nqo2'
ID 632127
Institutional Source Beutler Lab
Gene Symbol Nqo2
Ensembl Gene ENSMUSG00000046949
Gene Name N-ribosyldihydronicotinamide quinone reductase 2
Synonyms Nmor2, Ox-2, NRH: quinone oxidoreductase, Ox2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock # R8133 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 33964687-33988443 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 33985478 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 228 (Y228H)
Ref Sequence ENSEMBL: ENSMUSP00000021843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021843] [ENSMUST00000058978] [ENSMUST00000076532] [ENSMUST00000166354] [ENSMUST00000167237] [ENSMUST00000168400] [ENSMUST00000171034] [ENSMUST00000220844] [ENSMUST00000222740] [ENSMUST00000223479]
AlphaFold Q9JI75
Predicted Effect probably benign
Transcript: ENSMUST00000021843
AA Change: Y228H

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000021843
Gene: ENSMUSG00000046949
AA Change: Y228H

DomainStartEndE-ValueType
Pfam:FMN_red 4 159 5.6e-15 PFAM
Pfam:Flavodoxin_2 4 212 3.5e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058978
AA Change: Y228H

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000053809
Gene: ENSMUSG00000046949
AA Change: Y228H

DomainStartEndE-ValueType
Pfam:FMN_red 4 158 2e-14 PFAM
Pfam:Flavodoxin_2 4 212 2.6e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076532
SMART Domains Protein: ENSMUSP00000075848
Gene: ENSMUSG00000060147

DomainStartEndE-ValueType
SERPIN 13 378 2.84e-179 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166354
SMART Domains Protein: ENSMUSP00000126287
Gene: ENSMUSG00000060147

DomainStartEndE-ValueType
Pfam:Serpin 6 66 3.8e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167237
Predicted Effect probably benign
Transcript: ENSMUST00000168400
SMART Domains Protein: ENSMUSP00000126450
Gene: ENSMUSG00000060147

DomainStartEndE-ValueType
Pfam:Serpin 6 120 3.5e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171034
SMART Domains Protein: ENSMUSP00000132433
Gene: ENSMUSG00000060147

DomainStartEndE-ValueType
SERPIN 13 228 3.54e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220844
AA Change: Y184H

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000222740
AA Change: Y228H

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000223479
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.9%
  • 20x: 96.3%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the thioredoxin family of enzymes. It is a cytosolic and ubiquitously expressed flavoprotein that catalyzes the two-electron reduction of quinone substrates and uses dihydronicotinamide riboside as a reducing coenzyme. Mutations in this gene have been associated with neurodegenerative diseases and several cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygouse for disruptions in this gene have an essentially normal phenotype but with abnormalities in WBC counts and increased susceptibility to chemically induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A T 11: 110,127,463 S1110R possibly damaging Het
Adam15 C T 3: 89,347,206 R123Q probably benign Het
AI987944 A G 7: 41,375,065 probably null Het
Ankrd31 T C 13: 96,866,495 probably null Het
Arfgef3 C A 10: 18,611,203 probably null Het
Atp6v0c C T 17: 24,164,579 S98N possibly damaging Het
Camsap1 T C 2: 25,934,297 N1417S probably damaging Het
Cct7 T C 6: 85,461,063 S96P probably damaging Het
Cd38 C A 5: 43,901,448 L135M probably damaging Het
Cib4 T C 5: 30,534,218 D53G probably benign Het
Cntn6 T A 6: 104,728,337 S244T probably benign Het
Cubn G T 2: 13,388,848 D1447E probably damaging Het
Ebf3 T C 7: 137,313,143 E102G probably damaging Het
Elmo1 T A 13: 20,373,086 V399E probably damaging Het
Etl4 A G 2: 20,806,271 E1423G possibly damaging Het
Glis3 A G 19: 28,350,006 S669P probably benign Het
Gm609 T C 16: 45,443,941 T85A probably benign Het
Hipk1 T C 3: 103,753,394 T742A possibly damaging Het
Igdcc4 C A 9: 65,131,741 T890N possibly damaging Het
Jcad C T 18: 4,649,384 T85I probably benign Het
Kmt2d T C 15: 98,864,942 K316E probably damaging Het
Lrig1 T C 6: 94,611,629 D513G possibly damaging Het
Lrrn4 T C 2: 132,878,014 N289D probably damaging Het
Mcf2l A G 8: 13,011,487 M829V probably damaging Het
Mib2 C T 4: 155,657,001 R495H probably benign Het
Nrg2 T A 18: 36,032,377 E394V probably benign Het
Oas1e T C 5: 120,787,995 N336S probably benign Het
Olfr1443 T G 19: 12,680,480 V124G probably damaging Het
Olfr548-ps1 T A 7: 102,542,858 H307Q probably benign Het
Olfr641 G T 7: 104,039,915 G40W probably benign Het
Pax4 T C 6: 28,442,514 D305G probably benign Het
Pcdhb16 T A 18: 37,478,132 N48K probably damaging Het
Pcdhb20 G T 18: 37,506,610 E730* probably null Het
Pde4a A T 9: 21,191,377 D119V possibly damaging Het
Pgam1 T C 19: 41,915,710 V82A probably benign Het
Phf11a C T 14: 59,284,324 G133S probably damaging Het
Phlpp1 TGCGCGCGCGC TGCGCGCGC 1: 106,172,792 probably null Het
Piwil1 T C 5: 128,749,850 V558A probably damaging Het
Prpf40b T C 15: 99,304,438 V59A unknown Het
Psd4 T A 2: 24,396,689 S353T probably benign Het
Rnf219 G T 14: 104,479,245 S564* probably null Het
Ryr2 A T 13: 11,603,698 L3877H probably damaging Het
S100a2 T C 3: 90,591,309 V39A possibly damaging Het
Tanc2 T A 11: 105,923,222 S1831T probably damaging Het
Zfhx4 A G 3: 5,400,494 K1904R probably damaging Het
Zfp141 A G 7: 42,475,057 C664R probably damaging Het
Other mutations in Nqo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02135:Nqo2 APN 13 33985343 nonsense probably null
IGL02884:Nqo2 APN 13 33972361 missense probably damaging 1.00
R0021:Nqo2 UTSW 13 33981507 missense probably benign
R0021:Nqo2 UTSW 13 33981507 missense probably benign
R0848:Nqo2 UTSW 13 33972478 critical splice donor site probably null
R0853:Nqo2 UTSW 13 33979577 missense probably benign
R3417:Nqo2 UTSW 13 33979633 missense probably benign 0.01
R4110:Nqo2 UTSW 13 33979637 missense probably benign 0.00
R4936:Nqo2 UTSW 13 33981518 missense probably damaging 1.00
R5861:Nqo2 UTSW 13 33972430 missense probably damaging 1.00
R6161:Nqo2 UTSW 13 33979651 missense probably damaging 0.99
R6599:Nqo2 UTSW 13 33979556 missense probably damaging 1.00
R7909:Nqo2 UTSW 13 33972431 missense probably damaging 1.00
R8495:Nqo2 UTSW 13 33981494 missense probably damaging 1.00
R8543:Nqo2 UTSW 13 33985314 critical splice acceptor site probably null
R9211:Nqo2 UTSW 13 33972416 missense probably benign 0.08
R9605:Nqo2 UTSW 13 33972378 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TGGCTTCAGCATGGTACAC -3'
(R):5'- AAGCAATTCCCACTGCCCTG -3'

Sequencing Primer
(F):5'- CACTGCACTTCTGTGGATTTAAAGTC -3'
(R):5'- CAGTGCAACAAGCTGACTTTTG -3'
Posted On 2020-06-30