Incidental Mutation 'R0011:Casc1'
ID63213
Institutional Source Beutler Lab
Gene Symbol Casc1
Ensembl Gene ENSMUSG00000043541
Gene Namecancer susceptibility candidate 1
SynonymsA230084G12Rik, Las1
MMRRC Submission 038306-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R0011 (G1)
Quality Score158
Status Validated
Chromosome6
Chromosomal Location145174834-145211005 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 145179055 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 515 (M515L)
Ref Sequence ENSEMBL: ENSMUSP00000144783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032396] [ENSMUST00000060797] [ENSMUST00000111728] [ENSMUST00000135984] [ENSMUST00000204105]
Predicted Effect probably benign
Transcript: ENSMUST00000032396
SMART Domains Protein: ENSMUSP00000032396
Gene: ENSMUSG00000030263

DomainStartEndE-ValueType
Pfam:MRVI1 10 539 3.2e-265 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000060797
AA Change: M515L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000062279
Gene: ENSMUSG00000043541
AA Change: M515L

DomainStartEndE-ValueType
low complexity region 1 14 N/A INTRINSIC
Pfam:Casc1_N 29 229 5.5e-61 PFAM
Pfam:Casc1 241 469 3.4e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000111727
Predicted Effect probably damaging
Transcript: ENSMUST00000111728
AA Change: M502L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000107357
Gene: ENSMUSG00000043541
AA Change: M502L

DomainStartEndE-ValueType
coiled coil region 1 45 N/A INTRINSIC
Pfam:Casc1 228 456 6.1e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132948
SMART Domains Protein: ENSMUSP00000120248
Gene: ENSMUSG00000030263

DomainStartEndE-ValueType
Pfam:MRVI1 8 504 3.7e-248 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135191
Predicted Effect probably benign
Transcript: ENSMUST00000135984
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141307
Predicted Effect probably damaging
Transcript: ENSMUST00000204105
AA Change: M515L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000144783
Gene: ENSMUSG00000043541
AA Change: M515L

DomainStartEndE-ValueType
low complexity region 1 14 N/A INTRINSIC
Pfam:Casc1_N 29 229 3.4e-57 PFAM
Pfam:Casc1 241 469 2.3e-11 PFAM
Meta Mutation Damage Score 0.1298 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency 100% (59/59)
MGI Phenotype PHENOTYPE: Mice with disruptions of this gene display a higher incidence of lung tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik T A 7: 131,229,993 L389Q probably damaging Het
A930011G23Rik T C 5: 99,232,354 Y344C probably damaging Het
Alox15 A G 11: 70,349,596 V253A possibly damaging Het
Ank3 A G 10: 69,979,451 probably benign Het
Art3 T A 5: 92,403,612 Y17N probably damaging Het
Asic3 C T 5: 24,417,492 probably benign Het
Bach2 G T 4: 32,244,655 probably benign Het
Brip1 C A 11: 86,186,998 K201N possibly damaging Het
Ccdc88a T C 11: 29,374,364 F6S probably damaging Het
Celsr2 A G 3: 108,413,402 I698T probably benign Het
Cenpf A G 1: 189,650,706 S2664P probably benign Het
Cfap54 A T 10: 93,065,225 C156S probably damaging Het
Cops4 C A 5: 100,527,981 Q28K probably benign Het
Cyb5a T A 18: 84,877,822 probably benign Het
Diaph3 A T 14: 86,866,408 C847S probably damaging Het
Dnah3 T C 7: 120,019,701 K1648R probably damaging Het
Emilin2 C T 17: 71,273,868 G621E probably benign Het
Enpp1 T A 10: 24,670,002 K228* probably null Het
Epg5 T C 18: 77,948,483 C132R probably benign Het
Epha7 G A 4: 28,962,564 D961N probably benign Het
G6pc2 C A 2: 69,226,565 probably benign Het
Gm7361 C T 5: 26,258,878 probably benign Het
Grin2c T C 11: 115,255,750 Y476C probably damaging Het
Hnrnpul1 T G 7: 25,742,915 probably benign Het
Igf2bp1 T C 11: 96,005,584 D17G probably damaging Het
Insrr T C 3: 87,809,616 C688R possibly damaging Het
Itgb2l T C 16: 96,427,661 probably benign Het
Kidins220 T A 12: 24,999,352 V322E probably damaging Het
Klk1 C T 7: 44,229,535 T149I probably benign Het
Mbd3l1 A G 9: 18,484,567 probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mrc1 T C 2: 14,261,337 probably null Het
Mtr T C 13: 12,238,052 probably benign Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Npy4r C T 14: 34,146,723 V203M probably damaging Het
Olfr965 T A 9: 39,719,627 N133K probably benign Het
Pik3r4 C A 9: 105,644,637 T134K probably benign Het
Rdh19 T A 10: 127,856,911 L149Q probably damaging Het
Sema3e C T 5: 14,144,011 R85* probably null Het
Shtn1 A G 19: 59,032,218 S191P possibly damaging Het
Slc39a11 A T 11: 113,247,833 F279L probably benign Het
Slc4a1 T C 11: 102,357,110 K353E possibly damaging Het
Slc6a18 A T 13: 73,665,619 M515K possibly damaging Het
Snapc4 A G 2: 26,364,813 I1225T probably benign Het
Spidr A T 16: 15,966,603 W534R probably benign Het
Tmem202 T A 9: 59,524,801 N81I probably benign Het
Tnfrsf1b T G 4: 145,222,966 R297S possibly damaging Het
Trim55 A G 3: 19,670,999 T227A probably benign Het
Trim58 A T 11: 58,643,120 T167S probably benign Het
Trp53i11 A T 2: 93,199,353 probably benign Het
Ttn T C 2: 76,810,355 H5356R probably damaging Het
Tyrp1 C T 4: 80,840,793 T301I probably damaging Het
Wdr17 A T 8: 54,672,501 I448K possibly damaging Het
Wscd1 T C 11: 71,788,828 V509A probably damaging Het
Zfp251 A G 15: 76,854,554 V108A probably benign Het
Other mutations in Casc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Casc1 APN 6 145175290 missense probably benign 0.00
IGL00586:Casc1 APN 6 145191576 missense possibly damaging 0.53
IGL01066:Casc1 APN 6 145176222 missense probably damaging 0.96
IGL01413:Casc1 APN 6 145175086 missense probably damaging 1.00
IGL02275:Casc1 APN 6 145177364 missense probably damaging 1.00
IGL02668:Casc1 APN 6 145205257 missense unknown
IGL03018:Casc1 APN 6 145183305 missense probably damaging 1.00
IGL03233:Casc1 APN 6 145181885 missense probably damaging 1.00
R0011:Casc1 UTSW 6 145179055 missense probably damaging 1.00
R0180:Casc1 UTSW 6 145183218 critical splice donor site probably benign
R0786:Casc1 UTSW 6 145181757 critical splice donor site probably null
R1916:Casc1 UTSW 6 145176200 missense probably benign 0.37
R2117:Casc1 UTSW 6 145205241 critical splice donor site probably null
R2174:Casc1 UTSW 6 145175170 missense probably damaging 1.00
R2264:Casc1 UTSW 6 145208429 utr 5 prime probably benign
R4393:Casc1 UTSW 6 145194578 missense possibly damaging 0.49
R4467:Casc1 UTSW 6 145183218 critical splice donor site probably null
R4847:Casc1 UTSW 6 145175185 missense probably damaging 1.00
R5014:Casc1 UTSW 6 145183266 missense probably damaging 1.00
R5207:Casc1 UTSW 6 145179068 missense probably damaging 1.00
R5264:Casc1 UTSW 6 145181776 missense probably benign 0.02
R5359:Casc1 UTSW 6 145196892 missense probably damaging 1.00
R5499:Casc1 UTSW 6 145177431 missense probably damaging 1.00
R6211:Casc1 UTSW 6 145200491 missense probably damaging 1.00
R6579:Casc1 UTSW 6 145179018 missense probably benign 0.19
R6939:Casc1 UTSW 6 145175219 missense possibly damaging 0.46
R7108:Casc1 UTSW 6 145185865 nonsense probably null
R7131:Casc1 UTSW 6 145177406 missense probably null 0.97
R7810:Casc1 UTSW 6 145194586 missense probably benign 0.28
X0063:Casc1 UTSW 6 145175271 missense probably benign 0.13
Z1176:Casc1 UTSW 6 145205293 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCAGAGACATCTTACATGCCTGCC -3'
(R):5'- TGTACAGAGCCAGGGGAGAATTACC -3'

Sequencing Primer
(F):5'- CTGGGGACACACTGCCTAAC -3'
(R):5'- CCTCCAGTGCCAGGAAGAATATG -3'
Posted On2013-07-30