Incidental Mutation 'R0011:Hnrnpul1'
ID63214
Institutional Source Beutler Lab
Gene Symbol Hnrnpul1
Ensembl Gene ENSMUSG00000040725
Gene Nameheterogeneous nuclear ribonucleoprotein U-like 1
SynonymsE1B-AP5, E130317O14Rik, E1BAP5, Hnrpul1, Hnrnpul
MMRRC Submission 038306-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.618) question?
Stock #R0011 (G1)
Quality Score173
Status Validated
Chromosome7
Chromosomal Location25721165-25754757 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to G at 25742915 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043765] [ENSMUST00000108401] [ENSMUST00000206832]
Predicted Effect probably benign
Transcript: ENSMUST00000043765
SMART Domains Protein: ENSMUSP00000037268
Gene: ENSMUSG00000040725

DomainStartEndE-ValueType
SAP 3 37 2.86e-10 SMART
low complexity region 62 74 N/A INTRINSIC
low complexity region 78 91 N/A INTRINSIC
low complexity region 201 209 N/A INTRINSIC
SPRY 255 388 8.49e-41 SMART
Pfam:AAA_33 424 569 1.4e-29 PFAM
low complexity region 613 626 N/A INTRINSIC
low complexity region 631 693 N/A INTRINSIC
low complexity region 695 718 N/A INTRINSIC
low complexity region 745 765 N/A INTRINSIC
low complexity region 768 859 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108401
SMART Domains Protein: ENSMUSP00000104038
Gene: ENSMUSG00000040725

DomainStartEndE-ValueType
SAP 3 37 2.86e-10 SMART
low complexity region 62 74 N/A INTRINSIC
low complexity region 78 91 N/A INTRINSIC
low complexity region 201 209 N/A INTRINSIC
Pfam:SPRY 255 338 2e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206041
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206260
Predicted Effect probably benign
Transcript: ENSMUST00000206832
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear RNA-binding protein of the heterogeneous nuclear ribonucleoprotein (hnRNP) family. This protein binds specifically to adenovirus early-1B-55kDa oncoprotein. It may play an important role in nucleocytoplasmic RNA transport, and its function is modulated by early-1B-55kDa in adenovirus-infected cells. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik T A 7: 131,229,993 L389Q probably damaging Het
A930011G23Rik T C 5: 99,232,354 Y344C probably damaging Het
Alox15 A G 11: 70,349,596 V253A possibly damaging Het
Ank3 A G 10: 69,979,451 probably benign Het
Art3 T A 5: 92,403,612 Y17N probably damaging Het
Asic3 C T 5: 24,417,492 probably benign Het
Bach2 G T 4: 32,244,655 probably benign Het
Brip1 C A 11: 86,186,998 K201N possibly damaging Het
Casc1 T A 6: 145,179,055 M515L probably damaging Het
Ccdc88a T C 11: 29,374,364 F6S probably damaging Het
Celsr2 A G 3: 108,413,402 I698T probably benign Het
Cenpf A G 1: 189,650,706 S2664P probably benign Het
Cfap54 A T 10: 93,065,225 C156S probably damaging Het
Cops4 C A 5: 100,527,981 Q28K probably benign Het
Cyb5a T A 18: 84,877,822 probably benign Het
Diaph3 A T 14: 86,866,408 C847S probably damaging Het
Dnah3 T C 7: 120,019,701 K1648R probably damaging Het
Emilin2 C T 17: 71,273,868 G621E probably benign Het
Enpp1 T A 10: 24,670,002 K228* probably null Het
Epg5 T C 18: 77,948,483 C132R probably benign Het
Epha7 G A 4: 28,962,564 D961N probably benign Het
G6pc2 C A 2: 69,226,565 probably benign Het
Gm7361 C T 5: 26,258,878 probably benign Het
Grin2c T C 11: 115,255,750 Y476C probably damaging Het
Igf2bp1 T C 11: 96,005,584 D17G probably damaging Het
Insrr T C 3: 87,809,616 C688R possibly damaging Het
Itgb2l T C 16: 96,427,661 probably benign Het
Kidins220 T A 12: 24,999,352 V322E probably damaging Het
Klk1 C T 7: 44,229,535 T149I probably benign Het
Mbd3l1 A G 9: 18,484,567 probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mrc1 T C 2: 14,261,337 probably null Het
Mtr T C 13: 12,238,052 probably benign Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Npy4r C T 14: 34,146,723 V203M probably damaging Het
Olfr965 T A 9: 39,719,627 N133K probably benign Het
Pik3r4 C A 9: 105,644,637 T134K probably benign Het
Rdh19 T A 10: 127,856,911 L149Q probably damaging Het
Sema3e C T 5: 14,144,011 R85* probably null Het
Shtn1 A G 19: 59,032,218 S191P possibly damaging Het
Slc39a11 A T 11: 113,247,833 F279L probably benign Het
Slc4a1 T C 11: 102,357,110 K353E possibly damaging Het
Slc6a18 A T 13: 73,665,619 M515K possibly damaging Het
Snapc4 A G 2: 26,364,813 I1225T probably benign Het
Spidr A T 16: 15,966,603 W534R probably benign Het
Tmem202 T A 9: 59,524,801 N81I probably benign Het
Tnfrsf1b T G 4: 145,222,966 R297S possibly damaging Het
Trim55 A G 3: 19,670,999 T227A probably benign Het
Trim58 A T 11: 58,643,120 T167S probably benign Het
Trp53i11 A T 2: 93,199,353 probably benign Het
Ttn T C 2: 76,810,355 H5356R probably damaging Het
Tyrp1 C T 4: 80,840,793 T301I probably damaging Het
Wdr17 A T 8: 54,672,501 I448K possibly damaging Het
Wscd1 T C 11: 71,788,828 V509A probably damaging Het
Zfp251 A G 15: 76,854,554 V108A probably benign Het
Other mutations in Hnrnpul1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Hnrnpul1 APN 7 25726154 missense possibly damaging 0.74
IGL01287:Hnrnpul1 APN 7 25726898 missense probably damaging 1.00
IGL01409:Hnrnpul1 APN 7 25724652 missense unknown
IGL02026:Hnrnpul1 APN 7 25745162 missense probably damaging 0.99
IGL02073:Hnrnpul1 APN 7 25722341 unclassified probably benign
IGL02474:Hnrnpul1 APN 7 25726757 missense probably benign 0.02
IGL02839:Hnrnpul1 APN 7 25733242 critical splice donor site probably null
IGL02894:Hnrnpul1 APN 7 25750904 missense possibly damaging 0.70
IGL03382:Hnrnpul1 APN 7 25750984 start codon destroyed probably null 0.53
R0525:Hnrnpul1 UTSW 7 25740883 missense possibly damaging 0.72
R0587:Hnrnpul1 UTSW 7 25745232 missense possibly damaging 0.70
R1121:Hnrnpul1 UTSW 7 25740907 missense possibly damaging 0.68
R1313:Hnrnpul1 UTSW 7 25722916 unclassified probably benign
R1313:Hnrnpul1 UTSW 7 25722916 unclassified probably benign
R1880:Hnrnpul1 UTSW 7 25733098 missense possibly damaging 0.95
R1892:Hnrnpul1 UTSW 7 25726766 missense probably benign 0.11
R2113:Hnrnpul1 UTSW 7 25733269 missense possibly damaging 0.47
R2194:Hnrnpul1 UTSW 7 25725922 critical splice donor site probably null
R2269:Hnrnpul1 UTSW 7 25750874 missense probably damaging 0.98
R2679:Hnrnpul1 UTSW 7 25726875 missense probably damaging 1.00
R3079:Hnrnpul1 UTSW 7 25733115 nonsense probably null
R3917:Hnrnpul1 UTSW 7 25726875 missense probably damaging 1.00
R4077:Hnrnpul1 UTSW 7 25726875 missense probably damaging 1.00
R4079:Hnrnpul1 UTSW 7 25726875 missense probably damaging 1.00
R4181:Hnrnpul1 UTSW 7 25726812 missense probably damaging 0.98
R4449:Hnrnpul1 UTSW 7 25722284 unclassified probably benign
R4707:Hnrnpul1 UTSW 7 25726833 missense probably damaging 1.00
R4764:Hnrnpul1 UTSW 7 25743011 missense probably benign 0.00
R5040:Hnrnpul1 UTSW 7 25742989 missense possibly damaging 0.86
R5131:Hnrnpul1 UTSW 7 25726794 missense probably benign 0.08
R5224:Hnrnpul1 UTSW 7 25745175 missense probably damaging 0.98
R5599:Hnrnpul1 UTSW 7 25754672 start gained probably benign
R5975:Hnrnpul1 UTSW 7 25754359 missense possibly damaging 0.93
R7032:Hnrnpul1 UTSW 7 25750894 missense probably benign 0.11
R7195:Hnrnpul1 UTSW 7 25724778 missense unknown
R7231:Hnrnpul1 UTSW 7 25748417 nonsense probably null
R7667:Hnrnpul1 UTSW 7 25754421 missense probably damaging 0.99
R8060:Hnrnpul1 UTSW 7 25748343 missense not run
Z1176:Hnrnpul1 UTSW 7 25724664 missense not run
Z1176:Hnrnpul1 UTSW 7 25724698 missense not run
Predicted Primers PCR Primer
(F):5'- AAAGACAGTCACTGAGCCTGGCAG -3'
(R):5'- ACCCACCAGCTTTAAGAGAATTGATCC -3'

Sequencing Primer
(F):5'- CCCAAAAGAGTTGTTTCCGATAGG -3'
(R):5'- GAGAATTGATCCTGAGCATTCTTG -3'
Posted On2013-07-30