Incidental Mutation 'R8134:Rrs1'
ID 632142
Institutional Source Beutler Lab
Gene Symbol Rrs1
Ensembl Gene ENSMUSG00000061024
Gene Name ribosome biogenesis regulator 1
Synonyms D1Ertd701e, 5730466A07Rik
MMRRC Submission 067562-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8134 (G1)
Quality Score 89.0077
Status Validated
Chromosome 1
Chromosomal Location 9615633-9617680 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) C to T at 9615645 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000027044] [ENSMUST00000072079] [ENSMUST00000130927] [ENSMUST00000144177] [ENSMUST00000186467]
AlphaFold Q9CYH6
Predicted Effect probably benign
Transcript: ENSMUST00000027044
Predicted Effect probably benign
Transcript: ENSMUST00000072079
SMART Domains Protein: ENSMUSP00000071955
Gene: ENSMUSG00000061024

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
Pfam:RRS1 31 193 3.5e-62 PFAM
low complexity region 302 337 N/A INTRINSIC
low complexity region 351 365 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130927
Predicted Effect probably benign
Transcript: ENSMUST00000144177
SMART Domains Protein: ENSMUSP00000116627
Gene: ENSMUSG00000025911

DomainStartEndE-ValueType
Pfam:Fe-ADH 50 454 2.1e-105 PFAM
Pfam:Fe-ADH_2 53 155 6.5e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186467
Predicted Effect probably benign
Transcript: ENSMUST00000190654
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.5%
  • 20x: 93.5%
Validation Efficiency 99% (71/72)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abce1 G A 8: 80,425,982 (GRCm39) P265L probably benign Het
Adam20 A G 8: 41,249,101 (GRCm39) T404A probably benign Het
Anp32a G T 9: 62,284,863 (GRCm39) R237L unknown Het
Ascc3 A G 10: 50,643,554 (GRCm39) D1835G probably benign Het
Atg9b A G 5: 24,590,220 (GRCm39) probably null Het
Bard1 A T 1: 71,106,297 (GRCm39) N443K probably damaging Het
Btnl1 A G 17: 34,604,647 (GRCm39) D476G possibly damaging Het
C2cd3 A T 7: 100,067,711 (GRCm39) I487F Het
Cadm4 A G 7: 24,203,030 (GRCm39) E384G possibly damaging Het
Camsap3 A G 8: 3,648,075 (GRCm39) K128E probably benign Het
Casz1 C T 4: 149,027,492 (GRCm39) P1005S probably damaging Het
Cd38 C A 5: 44,058,790 (GRCm39) L135M probably damaging Het
Cdk20 A G 13: 64,585,734 (GRCm39) E244G probably benign Het
Cfap54 A T 10: 92,714,378 (GRCm39) V2667D unknown Het
Col11a1 A G 3: 114,012,435 (GRCm39) K1792E unknown Het
Cpne9 A T 6: 113,272,003 (GRCm39) D377V probably benign Het
Csmd1 A T 8: 15,982,550 (GRCm39) C2706S probably damaging Het
Ctnnbl1 T C 2: 157,651,391 (GRCm39) V222A probably benign Het
Frmpd2 T C 14: 33,227,452 (GRCm39) S277P probably benign Het
Herc2 C T 7: 55,734,884 (GRCm39) T158I probably benign Het
Hoxa4 G T 6: 52,167,537 (GRCm39) H215N possibly damaging Het
Hpd G T 5: 123,312,443 (GRCm39) Q309K probably benign Het
Il20ra A G 10: 19,626,452 (GRCm39) T159A probably damaging Het
Ints10 T A 8: 69,255,638 (GRCm39) Y209* probably null Het
Ints2 A G 11: 86,103,486 (GRCm39) I1190T probably damaging Het
Jhy A G 9: 40,872,188 (GRCm39) V107A probably null Het
Kdm4d C T 9: 14,374,532 (GRCm39) R442H probably damaging Het
Kifbp T C 10: 62,413,756 (GRCm39) Y134C probably benign Het
Klb A T 5: 65,540,958 (GRCm39) H1017L probably benign Het
Kndc1 T A 7: 139,481,285 (GRCm39) probably null Het
Krtap4-1 GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC 11: 99,518,660 (GRCm39) probably benign Het
Lrrn3 T C 12: 41,503,047 (GRCm39) I423M probably damaging Het
Magi2 T G 5: 20,596,365 (GRCm39) F274L probably damaging Het
Magi2 T A 5: 20,596,392 (GRCm39) D283E probably benign Het
Map3k19 A C 1: 127,751,492 (GRCm39) S620A probably damaging Het
Meis2 C T 2: 115,697,369 (GRCm39) M388I probably benign Het
Ms4a3 G C 19: 11,615,613 (GRCm39) H54Q probably benign Het
Nfe2l1 A T 11: 96,710,585 (GRCm39) M548K possibly damaging Het
Ninl C T 2: 150,792,234 (GRCm39) C763Y probably benign Het
Numa1 T C 7: 101,650,834 (GRCm39) F1522L probably benign Het
Or13a25 T A 7: 140,247,680 (GRCm39) I153N possibly damaging Het
Or2bd2 T C 7: 6,441,922 (GRCm39) probably benign Het
Pcdhgc3 G A 18: 37,939,916 (GRCm39) V106I probably benign Het
Phf3 A G 1: 30,863,552 (GRCm39) V152A unknown Het
Pira1 A G 7: 3,738,838 (GRCm39) S590P probably damaging Het
Plcg2 A T 8: 118,284,057 (GRCm39) D118V probably damaging Het
Pnpla1 A G 17: 29,097,443 (GRCm39) D203G probably damaging Het
Ppip5k2 A T 1: 97,672,888 (GRCm39) M474K probably benign Het
Ppp1r12b T C 1: 134,814,280 (GRCm39) E341G possibly damaging Het
Rictor C T 15: 6,801,635 (GRCm39) S441L probably benign Het
Scaf11 T C 15: 96,318,592 (GRCm39) N324S probably damaging Het
Spaca1 T A 4: 34,042,157 (GRCm39) probably null Het
Sun3 G T 11: 8,979,346 (GRCm39) D118E probably benign Het
Svop C T 5: 114,180,992 (GRCm39) V215I probably benign Het
Tbc1d15 A T 10: 115,045,474 (GRCm39) C497S probably damaging Het
Tdrd6 A T 17: 43,937,064 (GRCm39) I1328N probably damaging Het
Tuba8 T A 6: 121,198,381 (GRCm39) D116E probably benign Het
Ube2z A G 11: 95,949,200 (GRCm39) I213T possibly damaging Het
Ubqln4 G A 3: 88,462,797 (GRCm39) probably null Het
Vps13a A G 19: 16,631,718 (GRCm39) I2639T possibly damaging Het
Zfp217 G A 2: 169,961,571 (GRCm39) S252F possibly damaging Het
Zfp94 A T 7: 24,003,166 (GRCm39) V92E probably benign Het
Other mutations in Rrs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03098:Rrs1 UTSW 1 9,616,328 (GRCm39) frame shift probably null
PIT1430001:Rrs1 UTSW 1 9,616,150 (GRCm39) missense probably damaging 1.00
R0207:Rrs1 UTSW 1 9,615,992 (GRCm39) missense probably damaging 0.96
R0207:Rrs1 UTSW 1 9,615,987 (GRCm39) splice site probably null
R0577:Rrs1 UTSW 1 9,616,026 (GRCm39) splice site probably null
R1165:Rrs1 UTSW 1 9,615,992 (GRCm39) missense probably damaging 0.96
R1222:Rrs1 UTSW 1 9,616,080 (GRCm39) missense probably benign 0.00
R1238:Rrs1 UTSW 1 9,616,026 (GRCm39) splice site probably null
R1397:Rrs1 UTSW 1 9,615,992 (GRCm39) missense probably damaging 0.96
R1598:Rrs1 UTSW 1 9,616,137 (GRCm39) missense probably benign 0.15
R2338:Rrs1 UTSW 1 9,616,026 (GRCm39) splice site probably null
R4280:Rrs1 UTSW 1 9,616,364 (GRCm39) missense probably damaging 0.96
R4287:Rrs1 UTSW 1 9,616,448 (GRCm39) missense possibly damaging 0.82
R4287:Rrs1 UTSW 1 9,616,440 (GRCm39) missense probably damaging 1.00
R4298:Rrs1 UTSW 1 9,616,448 (GRCm39) missense possibly damaging 0.82
R4326:Rrs1 UTSW 1 9,616,566 (GRCm39) missense possibly damaging 0.95
R4475:Rrs1 UTSW 1 9,615,810 (GRCm39) missense probably damaging 1.00
R4566:Rrs1 UTSW 1 9,616,452 (GRCm39) missense probably damaging 1.00
R4986:Rrs1 UTSW 1 9,615,992 (GRCm39) missense probably damaging 0.96
R6597:Rrs1 UTSW 1 9,616,601 (GRCm39) missense probably damaging 0.98
R7529:Rrs1 UTSW 1 9,616,417 (GRCm39) missense probably benign
R7728:Rrs1 UTSW 1 9,616,623 (GRCm39) missense possibly damaging 0.78
R8799:Rrs1 UTSW 1 9,615,819 (GRCm39) missense probably damaging 1.00
R9060:Rrs1 UTSW 1 9,616,677 (GRCm39) missense probably damaging 1.00
R9360:Rrs1 UTSW 1 9,616,845 (GRCm39) makesense probably null
R9609:Rrs1 UTSW 1 9,616,518 (GRCm39) missense probably benign 0.30
R9685:Rrs1 UTSW 1 9,616,390 (GRCm39) missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- CATGCTGGGAAACGTAGTCC -3'
(R):5'- TTCTTCTTGGGACGGATTCC -3'

Sequencing Primer
(F):5'- TAGTCCCAACCAGGTCCTGAG -3'
(R):5'- ACGGATTCCCTTAAGGCGC -3'
Posted On 2020-06-30