Mutagenetix > Incidental Mutation

Incidental Mutation 'R8134:Bard1'

632143

Institutional Source

Beutler Lab

Gene Symbol

Bard1

Ensembl Gene

ENSMUSG00000026196

Gene Name

BRCA1 associated RING domain 1

Synonyms

ENSMUSG00000060893, ENSMUSG00000073653

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8134 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

71027498-71103146 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 71067138 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 443 (N443K)

Ref Sequence

ENSEMBL: ENSMUSP00000027393 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027393]

AlphaFold

O70445

Predicted Effect

probably damaging
Transcript: ENSMUST00000027393
AA Change: N443K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000027393
Gene: ENSMUSG00000026196
AA Change: N443K

Domain	Start	End	E-Value	Type
low complexity region	32	43	N/A	INTRINSIC
RING	44	80	3.71e-2	SMART
low complexity region	225	232	N/A	INTRINSIC
low complexity region	371	390	N/A	INTRINSIC
ANK	415	444	3.46e-4	SMART
ANK	448	477	8.32e-7	SMART
ANK	481	510	1.55e-6	SMART
BRCT	553	631	3.56e-10	SMART
BRCT	657	758	2.35e-10	SMART

Meta Mutation Damage Score

0.9218

Coding Region Coverage

1x: 99.8%
3x: 99.6%
10x: 98.5%
20x: 93.5%

Validation Efficiency

99% (71/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which interacts with the N-terminal region of BRCA1. In addition to its ability to bind BRCA1 in vivo and in vitro, it shares homology with the 2 most conserved regions of BRCA1: the N-terminal RING motif and the C-terminal BRCT domain. The RING motif is a cysteine-rich sequence found in a variety of proteins that regulate cell growth, including the products of tumor suppressor genes and dominant protooncogenes. This protein also contains 3 tandem ankyrin repeats. The BARD1/BRCA1 interaction is disrupted by tumorigenic amino acid substitutions in BRCA1, implying that the formation of a stable complex between these proteins may be an essential aspect of BRCA1 tumor suppression. This protein may be the target of oncogenic mutations in breast or ovarian cancer. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for disruptions of this gene fail to develop past the egg cylinder stage. The phenotype is similar to that of mice with homozygous for disruptions in Brca1 or homozygous for disruptions in both Bard1 and Brca1. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abce1	G	A	8: 79,699,353	P265L	probably benign	Het
Adam20	A	G	8: 40,796,064	T404A	probably benign	Het
Anp32a	G	T	9: 62,377,581	R237L	unknown	Het
Ascc3	A	G	10: 50,767,458	D1835G	probably benign	Het
Atg9b	A	G	5: 24,385,222		probably null	Het
Btnl1	A	G	17: 34,385,673	D476G	possibly damaging	Het
C2cd3	A	T	7: 100,418,504	I487F		Het
Cadm4	A	G	7: 24,503,605	E384G	possibly damaging	Het
Camsap3	A	G	8: 3,598,075	K128E	probably benign	Het
Casz1	C	T	4: 148,943,035	P1005S	probably damaging	Het
Cd38	C	A	5: 43,901,448	L135M	probably damaging	Het
Cdk20	A	G	13: 64,437,920	E244G	probably benign	Het
Cfap54	A	T	10: 92,878,516	V2667D	unknown	Het
Col11a1	A	G	3: 114,218,786	K1792E	unknown	Het
Cpne9	A	T	6: 113,295,042	D377V	probably benign	Het
Csmd1	A	T	8: 15,932,550	C2706S	probably damaging	Het
Ctnnbl1	T	C	2: 157,809,471	V222A	probably benign	Het
Frmpd2	T	C	14: 33,505,495	S277P	probably benign	Het
Gm15922	A	G	7: 3,735,839	S590P	probably damaging	Het
Herc2	C	T	7: 56,085,136	T158I	probably benign	Het
Hoxa4	G	T	6: 52,190,557	H215N	possibly damaging	Het
Hpd	G	T	5: 123,174,380	Q309K	probably benign	Het
Il20ra	A	G	10: 19,750,704	T159A	probably damaging	Het
Ints10	T	A	8: 68,802,986	Y209*	probably null	Het
Ints2	A	G	11: 86,212,660	I1190T	probably damaging	Het
Jhy	A	G	9: 40,960,892	V107A	probably null	Het
Kdm4d	C	T	9: 14,463,236	R442H	probably damaging	Het
Kif1bp	T	C	10: 62,577,977	Y134C	probably benign	Het
Klb	A	T	5: 65,383,615	H1017L	probably benign	Het
Kndc1	T	A	7: 139,901,369		probably null	Het
Krtap4-1	GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC	GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC	11: 99,627,834		probably benign	Het
Lrrn3	T	C	12: 41,453,048	I423M	probably damaging	Het
Magi2	T	G	5: 20,391,367	F274L	probably damaging	Het
Magi2	T	A	5: 20,391,394	D283E	probably benign	Het
Map3k19	A	C	1: 127,823,755	S620A	probably damaging	Het
Meis2	C	T	2: 115,866,888	M388I	probably benign	Het
Ms4a3	G	C	19: 11,638,249	H54Q	probably benign	Het
Nfe2l1	A	T	11: 96,819,759	M548K	possibly damaging	Het
Ninl	C	T	2: 150,950,314	C763Y	probably benign	Het
Numa1	T	C	7: 102,001,627	F1522L	probably benign	Het
Olfr1344	T	C	7: 6,438,923		probably benign	Het
Olfr539	T	A	7: 140,667,767	I153N	possibly damaging	Het
Pcdhgc3	G	A	18: 37,806,863	V106I	probably benign	Het
Phf3	A	G	1: 30,824,471	V152A	unknown	Het
Plcg2	A	T	8: 117,557,318	D118V	probably damaging	Het
Pnpla1	A	G	17: 28,878,469	D203G	probably damaging	Het
Ppip5k2	A	T	1: 97,745,163	M474K	probably benign	Het
Ppp1r12b	T	C	1: 134,886,542	E341G	possibly damaging	Het
Rictor	C	T	15: 6,772,154	S441L	probably benign	Het
Rrs1	C	T	1: 9,545,420		probably benign	Het
Scaf11	T	C	15: 96,420,711	N324S	probably damaging	Het
Spaca1	T	A	4: 34,042,157		probably null	Het
Sun3	G	T	11: 9,029,346	D118E	probably benign	Het
Svop	C	T	5: 114,042,931	V215I	probably benign	Het
Tbc1d15	A	T	10: 115,209,569	C497S	probably damaging	Het
Tdrd6	A	T	17: 43,626,173	I1328N	probably damaging	Het
Tuba8	T	A	6: 121,221,422	D116E	probably benign	Het
Ube2z	A	G	11: 96,058,374	I213T	possibly damaging	Het
Ubqln4	G	A	3: 88,555,490		probably null	Het
Vps13a	A	G	19: 16,654,354	I2639T	possibly damaging	Het
Zfp217	G	A	2: 170,119,651	S252F	possibly damaging	Het
Zfp94	A	T	7: 24,303,741	V92E	probably benign	Het

Other mutations in Bard1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00706:Bard1	APN	1	71031426	missense	probably benign	0.08
IGL02128:Bard1	APN	1	71075228	missense	possibly damaging	0.66
IGL02249:Bard1	APN	1	71053669	missense	probably damaging	1.00
IGL02552:Bard1	APN	1	71065656	splice site	probably benign
IGL02661:Bard1	APN	1	71075310	missense	probably damaging	1.00
IGL03087:Bard1	APN	1	71067130	missense	probably damaging	1.00
PIT4651001:Bard1	UTSW	1	71074928	missense	probably benign	0.00
R0096:Bard1	UTSW	1	71053730	splice site	probably benign
R0328:Bard1	UTSW	1	71046762	missense	probably benign	0.29
R0838:Bard1	UTSW	1	71030653	missense	probably damaging	1.00
R2007:Bard1	UTSW	1	71031403	missense	probably benign	0.00
R2055:Bard1	UTSW	1	71074872	missense	probably benign	0.00
R2110:Bard1	UTSW	1	71075391	nonsense	probably null
R2237:Bard1	UTSW	1	71074976	missense	probably damaging	1.00
R2416:Bard1	UTSW	1	71074652	missense	probably benign
R3054:Bard1	UTSW	1	71088231	missense	possibly damaging	0.77
R3055:Bard1	UTSW	1	71088231	missense	possibly damaging	0.77
R3056:Bard1	UTSW	1	71088231	missense	possibly damaging	0.77
R3871:Bard1	UTSW	1	71074940	missense	probably benign	0.05
R3905:Bard1	UTSW	1	71067180	missense	possibly damaging	0.70
R4117:Bard1	UTSW	1	71046763	missense	probably damaging	1.00
R4766:Bard1	UTSW	1	71075174	missense	probably benign	0.01
R5230:Bard1	UTSW	1	71053611	critical splice donor site	probably null
R5250:Bard1	UTSW	1	71074563	missense	probably damaging	1.00
R5531:Bard1	UTSW	1	71046721	missense	probably damaging	1.00
R5653:Bard1	UTSW	1	71031429	missense	probably benign
R6008:Bard1	UTSW	1	71030750	missense	possibly damaging	0.65
R7503:Bard1	UTSW	1	71030836	missense	probably damaging	1.00
R7543:Bard1	UTSW	1	71075430	missense	probably damaging	1.00
R7750:Bard1	UTSW	1	71066942	splice site	probably null
R8714:Bard1	UTSW	1	71030827	missense	probably damaging	1.00
R9057:Bard1	UTSW	1	71030648	missense	probably damaging	1.00
R9534:Bard1	UTSW	1	71075030	missense	probably benign	0.45
V8831:Bard1	UTSW	1	71088217	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCCTGTCACAACTGAAAAGCTAG -3'
(R):5'- CATGAGCAGTAGTCGGCATG -3'

Sequencing Primer
(F):5'- TGGTCAAAGCATAAATTCTTCAGAC -3'
(R):5'- CATGAGCAGTAGTCGGCATGTAAAG -3'

Posted On

2020-06-30