Incidental Mutation 'R8134:Ctnnbl1'
ID 632149
Institutional Source Beutler Lab
Gene Symbol Ctnnbl1
Ensembl Gene ENSMUSG00000027649
Gene Name catenin, beta like 1
Synonyms NYD-SP19, 5730471K09Rik, P14L, FLJ21108
MMRRC Submission 067562-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.963) question?
Stock # R8134 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 157579321-157733534 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 157651391 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 222 (V222A)
Ref Sequence ENSEMBL: ENSMUSP00000029178 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029178]
AlphaFold Q9CWL8
Predicted Effect probably benign
Transcript: ENSMUST00000029178
AA Change: V222A

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000029178
Gene: ENSMUSG00000027649
AA Change: V222A

DomainStartEndE-ValueType
DUF1716 52 162 3.97e-61 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.5%
  • 20x: 93.5%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the pre-mRNA-processing factor 19-cell division cycle 5-like (PRP19-CDC5L) protein complex, which activates pre-mRNA splicing and is an integral part of the spliceosome. The encoded protein is also a nuclear localization sequence binding protein, and binds to activation-induced deaminase and is important for antibody diversification. This gene may also be associated with the development of obesity. Alternative splicing results in multiple transcript variants. A pseudogene of this gene has been defined on the X chromosome. [provided by RefSeq, Jul 2013]
PHENOTYPE:
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abce1 G A 8: 80,425,982 (GRCm39) P265L probably benign Het
Adam20 A G 8: 41,249,101 (GRCm39) T404A probably benign Het
Anp32a G T 9: 62,284,863 (GRCm39) R237L unknown Het
Ascc3 A G 10: 50,643,554 (GRCm39) D1835G probably benign Het
Atg9b A G 5: 24,590,220 (GRCm39) probably null Het
Bard1 A T 1: 71,106,297 (GRCm39) N443K probably damaging Het
Btnl1 A G 17: 34,604,647 (GRCm39) D476G possibly damaging Het
C2cd3 A T 7: 100,067,711 (GRCm39) I487F Het
Cadm4 A G 7: 24,203,030 (GRCm39) E384G possibly damaging Het
Camsap3 A G 8: 3,648,075 (GRCm39) K128E probably benign Het
Casz1 C T 4: 149,027,492 (GRCm39) P1005S probably damaging Het
Cd38 C A 5: 44,058,790 (GRCm39) L135M probably damaging Het
Cdk20 A G 13: 64,585,734 (GRCm39) E244G probably benign Het
Cfap54 A T 10: 92,714,378 (GRCm39) V2667D unknown Het
Col11a1 A G 3: 114,012,435 (GRCm39) K1792E unknown Het
Cpne9 A T 6: 113,272,003 (GRCm39) D377V probably benign Het
Csmd1 A T 8: 15,982,550 (GRCm39) C2706S probably damaging Het
Frmpd2 T C 14: 33,227,452 (GRCm39) S277P probably benign Het
Herc2 C T 7: 55,734,884 (GRCm39) T158I probably benign Het
Hoxa4 G T 6: 52,167,537 (GRCm39) H215N possibly damaging Het
Hpd G T 5: 123,312,443 (GRCm39) Q309K probably benign Het
Il20ra A G 10: 19,626,452 (GRCm39) T159A probably damaging Het
Ints10 T A 8: 69,255,638 (GRCm39) Y209* probably null Het
Ints2 A G 11: 86,103,486 (GRCm39) I1190T probably damaging Het
Jhy A G 9: 40,872,188 (GRCm39) V107A probably null Het
Kdm4d C T 9: 14,374,532 (GRCm39) R442H probably damaging Het
Kifbp T C 10: 62,413,756 (GRCm39) Y134C probably benign Het
Klb A T 5: 65,540,958 (GRCm39) H1017L probably benign Het
Kndc1 T A 7: 139,481,285 (GRCm39) probably null Het
Krtap4-1 GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC 11: 99,518,660 (GRCm39) probably benign Het
Lrrn3 T C 12: 41,503,047 (GRCm39) I423M probably damaging Het
Magi2 T G 5: 20,596,365 (GRCm39) F274L probably damaging Het
Magi2 T A 5: 20,596,392 (GRCm39) D283E probably benign Het
Map3k19 A C 1: 127,751,492 (GRCm39) S620A probably damaging Het
Meis2 C T 2: 115,697,369 (GRCm39) M388I probably benign Het
Ms4a3 G C 19: 11,615,613 (GRCm39) H54Q probably benign Het
Nfe2l1 A T 11: 96,710,585 (GRCm39) M548K possibly damaging Het
Ninl C T 2: 150,792,234 (GRCm39) C763Y probably benign Het
Numa1 T C 7: 101,650,834 (GRCm39) F1522L probably benign Het
Or13a25 T A 7: 140,247,680 (GRCm39) I153N possibly damaging Het
Or2bd2 T C 7: 6,441,922 (GRCm39) probably benign Het
Pcdhgc3 G A 18: 37,939,916 (GRCm39) V106I probably benign Het
Phf3 A G 1: 30,863,552 (GRCm39) V152A unknown Het
Pira1 A G 7: 3,738,838 (GRCm39) S590P probably damaging Het
Plcg2 A T 8: 118,284,057 (GRCm39) D118V probably damaging Het
Pnpla1 A G 17: 29,097,443 (GRCm39) D203G probably damaging Het
Ppip5k2 A T 1: 97,672,888 (GRCm39) M474K probably benign Het
Ppp1r12b T C 1: 134,814,280 (GRCm39) E341G possibly damaging Het
Rictor C T 15: 6,801,635 (GRCm39) S441L probably benign Het
Rrs1 C T 1: 9,615,645 (GRCm39) probably benign Het
Scaf11 T C 15: 96,318,592 (GRCm39) N324S probably damaging Het
Spaca1 T A 4: 34,042,157 (GRCm39) probably null Het
Sun3 G T 11: 8,979,346 (GRCm39) D118E probably benign Het
Svop C T 5: 114,180,992 (GRCm39) V215I probably benign Het
Tbc1d15 A T 10: 115,045,474 (GRCm39) C497S probably damaging Het
Tdrd6 A T 17: 43,937,064 (GRCm39) I1328N probably damaging Het
Tuba8 T A 6: 121,198,381 (GRCm39) D116E probably benign Het
Ube2z A G 11: 95,949,200 (GRCm39) I213T possibly damaging Het
Ubqln4 G A 3: 88,462,797 (GRCm39) probably null Het
Vps13a A G 19: 16,631,718 (GRCm39) I2639T possibly damaging Het
Zfp217 G A 2: 169,961,571 (GRCm39) S252F possibly damaging Het
Zfp94 A T 7: 24,003,166 (GRCm39) V92E probably benign Het
Other mutations in Ctnnbl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Ctnnbl1 APN 2 157,661,461 (GRCm39) missense possibly damaging 0.80
IGL01374:Ctnnbl1 APN 2 157,678,613 (GRCm39) critical splice donor site probably null
IGL01504:Ctnnbl1 APN 2 157,660,036 (GRCm39) splice site probably benign
IGL01622:Ctnnbl1 APN 2 157,661,468 (GRCm39) missense probably damaging 1.00
IGL01623:Ctnnbl1 APN 2 157,661,468 (GRCm39) missense probably damaging 1.00
IGL02146:Ctnnbl1 APN 2 157,661,414 (GRCm39) missense probably damaging 1.00
IGL02550:Ctnnbl1 APN 2 157,726,055 (GRCm39) missense probably benign 0.00
IGL03104:Ctnnbl1 APN 2 157,732,885 (GRCm39) missense probably damaging 0.99
IGL03164:Ctnnbl1 APN 2 157,659,681 (GRCm39) missense probably benign
R0482:Ctnnbl1 UTSW 2 157,713,110 (GRCm39) critical splice donor site probably null
R0826:Ctnnbl1 UTSW 2 157,641,337 (GRCm39) splice site probably benign
R0827:Ctnnbl1 UTSW 2 157,641,337 (GRCm39) splice site probably benign
R0862:Ctnnbl1 UTSW 2 157,641,337 (GRCm39) splice site probably benign
R0863:Ctnnbl1 UTSW 2 157,641,337 (GRCm39) splice site probably benign
R0864:Ctnnbl1 UTSW 2 157,641,337 (GRCm39) splice site probably benign
R1466:Ctnnbl1 UTSW 2 157,641,337 (GRCm39) splice site probably benign
R1533:Ctnnbl1 UTSW 2 157,678,563 (GRCm39) missense probably benign
R2971:Ctnnbl1 UTSW 2 157,713,106 (GRCm39) missense probably benign 0.06
R3522:Ctnnbl1 UTSW 2 157,713,113 (GRCm39) splice site probably null
R4296:Ctnnbl1 UTSW 2 157,661,490 (GRCm39) splice site probably null
R4982:Ctnnbl1 UTSW 2 157,678,473 (GRCm39) missense probably benign 0.01
R5396:Ctnnbl1 UTSW 2 157,659,752 (GRCm39) splice site probably null
R5857:Ctnnbl1 UTSW 2 157,631,018 (GRCm39) missense probably damaging 1.00
R7710:Ctnnbl1 UTSW 2 157,616,491 (GRCm39) missense probably benign 0.00
R7769:Ctnnbl1 UTSW 2 157,579,390 (GRCm39) start gained probably benign
R8324:Ctnnbl1 UTSW 2 157,621,735 (GRCm39) missense probably damaging 0.97
R8384:Ctnnbl1 UTSW 2 157,659,980 (GRCm39) missense probably benign 0.01
R8430:Ctnnbl1 UTSW 2 157,678,603 (GRCm39) missense probably damaging 0.99
R9116:Ctnnbl1 UTSW 2 157,648,623 (GRCm39) missense probably damaging 1.00
R9244:Ctnnbl1 UTSW 2 157,678,583 (GRCm39) missense possibly damaging 0.63
R9350:Ctnnbl1 UTSW 2 157,651,445 (GRCm39) missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CTGCGAATTCCGTCATTTTCAG -3'
(R):5'- GTCGGAGGATGTCTATCGAC -3'

Sequencing Primer
(F):5'- GCGAATTCCGTCATTTTCAGTTATG -3'
(R):5'- TGTCTATCGACACCATGGCAC -3'
Posted On 2020-06-30