Incidental Mutation 'R8134:Col11a1'
ID 632152
Institutional Source Beutler Lab
Gene Symbol Col11a1
Ensembl Gene ENSMUSG00000027966
Gene Name collagen, type XI, alpha 1
Synonyms C530001D20Rik
MMRRC Submission 067562-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.939) question?
Stock # R8134 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 113824189-114014367 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 114012435 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 1792 (K1792E)
Ref Sequence ENSEMBL: ENSMUSP00000089793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092155] [ENSMUST00000184978]
AlphaFold Q61245
Predicted Effect unknown
Transcript: ENSMUST00000092155
AA Change: K1792E
SMART Domains Protein: ENSMUSP00000089793
Gene: ENSMUSG00000027966
AA Change: K1792E

DomainStartEndE-ValueType
TSPN 37 228 1.83e-62 SMART
LamG 96 227 5.87e-11 SMART
low complexity region 256 276 N/A INTRINSIC
internal_repeat_4 357 431 3.12e-6 PROSPERO
Pfam:Collagen 433 491 2.6e-9 PFAM
Pfam:Collagen 525 586 5.9e-9 PFAM
low complexity region 611 632 N/A INTRINSIC
low complexity region 638 677 N/A INTRINSIC
Pfam:Collagen 721 805 3.6e-8 PFAM
internal_repeat_3 814 854 3.55e-9 PROSPERO
internal_repeat_1 818 869 2.01e-16 PROSPERO
low complexity region 872 944 N/A INTRINSIC
low complexity region 952 1001 N/A INTRINSIC
low complexity region 1031 1059 N/A INTRINSIC
low complexity region 1066 1100 N/A INTRINSIC
low complexity region 1103 1121 N/A INTRINSIC
internal_repeat_2 1124 1188 2.4e-12 PROSPERO
low complexity region 1189 1205 N/A INTRINSIC
low complexity region 1211 1232 N/A INTRINSIC
low complexity region 1235 1250 N/A INTRINSIC
low complexity region 1252 1368 N/A INTRINSIC
low complexity region 1373 1392 N/A INTRINSIC
low complexity region 1417 1448 N/A INTRINSIC
low complexity region 1453 1463 N/A INTRINSIC
Pfam:Collagen 1481 1543 8.3e-9 PFAM
COLFI 1574 1803 7.28e-127 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184978
SMART Domains Protein: ENSMUSP00000138879
Gene: ENSMUSG00000027966

DomainStartEndE-ValueType
Pfam:Collagen 1 57 6.3e-10 PFAM
Pfam:Collagen 49 110 3.2e-10 PFAM
Pfam:Collagen 95 165 6.2e-8 PFAM
Pfam:Collagen 242 318 2.2e-9 PFAM
Pfam:Collagen 289 362 1.6e-7 PFAM
Pfam:Collagen 341 403 2e-9 PFAM
COLFI 434 536 8.88e-12 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.5%
  • 20x: 93.5%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: This gene encodes the alpha-1 subunit of type XI collagen, one of the low abundance fibrillar collagens that is essential for normal embryonic skeletal development and the cohesive properties of cartilage. The encoded protein, in association with the alpha-1 subunit of type II collagen, forms a heterotrimeric type XI procollagen that undergoes proteolytic processing. Mice lacking the encoded protein develop severe chondrodysplasia and die at birth. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutation of this gene results in perinatal lethality by asphyxia. Mutants animals display weak tracheal cartilage, short snout, short mandible, cleft palate, short limbs, and externally rotated distal portion of the hindlimbs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abce1 G A 8: 80,425,982 (GRCm39) P265L probably benign Het
Adam20 A G 8: 41,249,101 (GRCm39) T404A probably benign Het
Anp32a G T 9: 62,284,863 (GRCm39) R237L unknown Het
Ascc3 A G 10: 50,643,554 (GRCm39) D1835G probably benign Het
Atg9b A G 5: 24,590,220 (GRCm39) probably null Het
Bard1 A T 1: 71,106,297 (GRCm39) N443K probably damaging Het
Btnl1 A G 17: 34,604,647 (GRCm39) D476G possibly damaging Het
C2cd3 A T 7: 100,067,711 (GRCm39) I487F Het
Cadm4 A G 7: 24,203,030 (GRCm39) E384G possibly damaging Het
Camsap3 A G 8: 3,648,075 (GRCm39) K128E probably benign Het
Casz1 C T 4: 149,027,492 (GRCm39) P1005S probably damaging Het
Cd38 C A 5: 44,058,790 (GRCm39) L135M probably damaging Het
Cdk20 A G 13: 64,585,734 (GRCm39) E244G probably benign Het
Cfap54 A T 10: 92,714,378 (GRCm39) V2667D unknown Het
Cpne9 A T 6: 113,272,003 (GRCm39) D377V probably benign Het
Csmd1 A T 8: 15,982,550 (GRCm39) C2706S probably damaging Het
Ctnnbl1 T C 2: 157,651,391 (GRCm39) V222A probably benign Het
Frmpd2 T C 14: 33,227,452 (GRCm39) S277P probably benign Het
Herc2 C T 7: 55,734,884 (GRCm39) T158I probably benign Het
Hoxa4 G T 6: 52,167,537 (GRCm39) H215N possibly damaging Het
Hpd G T 5: 123,312,443 (GRCm39) Q309K probably benign Het
Il20ra A G 10: 19,626,452 (GRCm39) T159A probably damaging Het
Ints10 T A 8: 69,255,638 (GRCm39) Y209* probably null Het
Ints2 A G 11: 86,103,486 (GRCm39) I1190T probably damaging Het
Jhy A G 9: 40,872,188 (GRCm39) V107A probably null Het
Kdm4d C T 9: 14,374,532 (GRCm39) R442H probably damaging Het
Kifbp T C 10: 62,413,756 (GRCm39) Y134C probably benign Het
Klb A T 5: 65,540,958 (GRCm39) H1017L probably benign Het
Kndc1 T A 7: 139,481,285 (GRCm39) probably null Het
Krtap4-1 GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC 11: 99,518,660 (GRCm39) probably benign Het
Lrrn3 T C 12: 41,503,047 (GRCm39) I423M probably damaging Het
Magi2 T G 5: 20,596,365 (GRCm39) F274L probably damaging Het
Magi2 T A 5: 20,596,392 (GRCm39) D283E probably benign Het
Map3k19 A C 1: 127,751,492 (GRCm39) S620A probably damaging Het
Meis2 C T 2: 115,697,369 (GRCm39) M388I probably benign Het
Ms4a3 G C 19: 11,615,613 (GRCm39) H54Q probably benign Het
Nfe2l1 A T 11: 96,710,585 (GRCm39) M548K possibly damaging Het
Ninl C T 2: 150,792,234 (GRCm39) C763Y probably benign Het
Numa1 T C 7: 101,650,834 (GRCm39) F1522L probably benign Het
Or13a25 T A 7: 140,247,680 (GRCm39) I153N possibly damaging Het
Or2bd2 T C 7: 6,441,922 (GRCm39) probably benign Het
Pcdhgc3 G A 18: 37,939,916 (GRCm39) V106I probably benign Het
Phf3 A G 1: 30,863,552 (GRCm39) V152A unknown Het
Pira1 A G 7: 3,738,838 (GRCm39) S590P probably damaging Het
Plcg2 A T 8: 118,284,057 (GRCm39) D118V probably damaging Het
Pnpla1 A G 17: 29,097,443 (GRCm39) D203G probably damaging Het
Ppip5k2 A T 1: 97,672,888 (GRCm39) M474K probably benign Het
Ppp1r12b T C 1: 134,814,280 (GRCm39) E341G possibly damaging Het
Rictor C T 15: 6,801,635 (GRCm39) S441L probably benign Het
Rrs1 C T 1: 9,615,645 (GRCm39) probably benign Het
Scaf11 T C 15: 96,318,592 (GRCm39) N324S probably damaging Het
Spaca1 T A 4: 34,042,157 (GRCm39) probably null Het
Sun3 G T 11: 8,979,346 (GRCm39) D118E probably benign Het
Svop C T 5: 114,180,992 (GRCm39) V215I probably benign Het
Tbc1d15 A T 10: 115,045,474 (GRCm39) C497S probably damaging Het
Tdrd6 A T 17: 43,937,064 (GRCm39) I1328N probably damaging Het
Tuba8 T A 6: 121,198,381 (GRCm39) D116E probably benign Het
Ube2z A G 11: 95,949,200 (GRCm39) I213T possibly damaging Het
Ubqln4 G A 3: 88,462,797 (GRCm39) probably null Het
Vps13a A G 19: 16,631,718 (GRCm39) I2639T possibly damaging Het
Zfp217 G A 2: 169,961,571 (GRCm39) S252F possibly damaging Het
Zfp94 A T 7: 24,003,166 (GRCm39) V92E probably benign Het
Other mutations in Col11a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00474:Col11a1 APN 3 113,860,182 (GRCm39) missense unknown
IGL00578:Col11a1 APN 3 113,987,755 (GRCm39) missense possibly damaging 0.95
IGL00742:Col11a1 APN 3 113,917,964 (GRCm39) missense unknown
IGL01014:Col11a1 APN 3 113,917,458 (GRCm39) splice site probably benign
IGL01099:Col11a1 APN 3 113,905,690 (GRCm39) nonsense probably null
IGL01129:Col11a1 APN 3 113,979,522 (GRCm39) splice site probably benign
IGL01474:Col11a1 APN 3 114,010,783 (GRCm39) utr 3 prime probably benign
IGL01884:Col11a1 APN 3 113,860,191 (GRCm39) missense unknown
IGL02104:Col11a1 APN 3 113,975,046 (GRCm39) critical splice donor site probably null
IGL02715:Col11a1 APN 3 113,923,058 (GRCm39) missense probably benign 0.06
IGL02978:Col11a1 APN 3 113,855,211 (GRCm39) missense unknown
IGL03203:Col11a1 APN 3 114,005,733 (GRCm39) missense possibly damaging 0.91
IGL03240:Col11a1 APN 3 114,010,859 (GRCm39) splice site probably null
IGL03357:Col11a1 APN 3 113,987,740 (GRCm39) missense probably damaging 1.00
IGL03390:Col11a1 APN 3 113,883,902 (GRCm39) missense unknown
gluon UTSW 3 114,010,819 (GRCm39) utr 3 prime probably benign
uncovered UTSW 3 113,906,116 (GRCm39) unclassified probably benign
weakforce UTSW 3 113,907,249 (GRCm39) missense unknown
R0110:Col11a1 UTSW 3 113,899,105 (GRCm39) splice site probably benign
R0144:Col11a1 UTSW 3 113,907,243 (GRCm39) missense unknown
R0432:Col11a1 UTSW 3 113,999,550 (GRCm39) splice site probably benign
R0468:Col11a1 UTSW 3 114,010,707 (GRCm39) utr 3 prime probably benign
R0510:Col11a1 UTSW 3 113,899,105 (GRCm39) splice site probably benign
R0535:Col11a1 UTSW 3 113,855,184 (GRCm39) missense unknown
R0608:Col11a1 UTSW 3 114,012,364 (GRCm39) utr 3 prime probably benign
R0826:Col11a1 UTSW 3 113,932,414 (GRCm39) missense unknown
R0827:Col11a1 UTSW 3 113,932,414 (GRCm39) missense unknown
R0862:Col11a1 UTSW 3 113,932,414 (GRCm39) missense unknown
R0863:Col11a1 UTSW 3 113,932,414 (GRCm39) missense unknown
R0926:Col11a1 UTSW 3 113,883,829 (GRCm39) missense unknown
R0980:Col11a1 UTSW 3 113,932,414 (GRCm39) missense unknown
R0981:Col11a1 UTSW 3 113,932,414 (GRCm39) missense unknown
R1004:Col11a1 UTSW 3 113,888,671 (GRCm39) splice site probably benign
R1037:Col11a1 UTSW 3 113,987,801 (GRCm39) missense probably damaging 1.00
R1171:Col11a1 UTSW 3 113,860,213 (GRCm39) missense unknown
R1316:Col11a1 UTSW 3 113,932,619 (GRCm39) splice site probably null
R1324:Col11a1 UTSW 3 113,824,565 (GRCm39) missense unknown
R1338:Col11a1 UTSW 3 114,010,644 (GRCm39) utr 3 prime probably benign
R1513:Col11a1 UTSW 3 113,890,803 (GRCm39) missense unknown
R1528:Col11a1 UTSW 3 114,010,644 (GRCm39) utr 3 prime probably benign
R1567:Col11a1 UTSW 3 113,932,261 (GRCm39) missense unknown
R1596:Col11a1 UTSW 3 113,946,262 (GRCm39) utr 3 prime probably benign
R1605:Col11a1 UTSW 3 113,925,290 (GRCm39) missense probably damaging 1.00
R1624:Col11a1 UTSW 3 113,951,804 (GRCm39) missense probably damaging 0.97
R1626:Col11a1 UTSW 3 113,925,218 (GRCm39) missense probably damaging 1.00
R1666:Col11a1 UTSW 3 113,855,184 (GRCm39) missense unknown
R1806:Col11a1 UTSW 3 113,951,791 (GRCm39) missense probably damaging 1.00
R2001:Col11a1 UTSW 3 113,958,942 (GRCm39) splice site probably null
R2084:Col11a1 UTSW 3 113,951,791 (GRCm39) missense probably damaging 1.00
R2085:Col11a1 UTSW 3 113,951,791 (GRCm39) missense probably damaging 1.00
R3926:Col11a1 UTSW 3 113,883,773 (GRCm39) splice site probably benign
R3950:Col11a1 UTSW 3 113,915,094 (GRCm39) critical splice donor site probably null
R3970:Col11a1 UTSW 3 113,890,838 (GRCm39) missense unknown
R4171:Col11a1 UTSW 3 114,001,863 (GRCm39) missense probably damaging 0.99
R4175:Col11a1 UTSW 3 114,001,872 (GRCm39) missense possibly damaging 0.83
R4176:Col11a1 UTSW 3 114,001,872 (GRCm39) missense possibly damaging 0.83
R4413:Col11a1 UTSW 3 113,901,965 (GRCm39) missense unknown
R4540:Col11a1 UTSW 3 113,890,815 (GRCm39) missense unknown
R5210:Col11a1 UTSW 3 113,946,806 (GRCm39) missense probably damaging 1.00
R5250:Col11a1 UTSW 3 114,010,819 (GRCm39) utr 3 prime probably benign
R5335:Col11a1 UTSW 3 113,888,889 (GRCm39) missense unknown
R5344:Col11a1 UTSW 3 114,002,011 (GRCm39) critical splice donor site probably null
R5394:Col11a1 UTSW 3 113,987,833 (GRCm39) splice site probably null
R5687:Col11a1 UTSW 3 114,010,752 (GRCm39) utr 3 prime probably benign
R5708:Col11a1 UTSW 3 113,890,743 (GRCm39) missense unknown
R5763:Col11a1 UTSW 3 113,888,245 (GRCm39) intron probably benign
R5792:Col11a1 UTSW 3 113,925,242 (GRCm39) missense probably damaging 1.00
R6259:Col11a1 UTSW 3 113,932,096 (GRCm39) missense probably benign
R6679:Col11a1 UTSW 3 113,946,368 (GRCm39) splice site probably null
R6738:Col11a1 UTSW 3 113,906,116 (GRCm39) unclassified probably benign
R6747:Col11a1 UTSW 3 114,006,099 (GRCm39) nonsense probably null
R6808:Col11a1 UTSW 3 113,888,593 (GRCm39) missense possibly damaging 0.87
R6861:Col11a1 UTSW 3 113,961,141 (GRCm39) missense probably damaging 1.00
R7201:Col11a1 UTSW 3 113,883,806 (GRCm39) missense unknown
R7264:Col11a1 UTSW 3 113,979,248 (GRCm39) missense unknown
R7393:Col11a1 UTSW 3 113,890,755 (GRCm39) missense unknown
R7445:Col11a1 UTSW 3 113,987,578 (GRCm39) missense unknown
R7479:Col11a1 UTSW 3 113,896,218 (GRCm39) missense unknown
R7548:Col11a1 UTSW 3 113,917,409 (GRCm39) missense unknown
R7683:Col11a1 UTSW 3 113,907,385 (GRCm39) missense unknown
R7747:Col11a1 UTSW 3 113,896,221 (GRCm39) missense unknown
R7809:Col11a1 UTSW 3 113,890,835 (GRCm39) missense unknown
R7951:Col11a1 UTSW 3 113,888,864 (GRCm39) missense unknown
R8057:Col11a1 UTSW 3 113,925,263 (GRCm39) missense unknown
R8139:Col11a1 UTSW 3 113,890,698 (GRCm39) missense unknown
R8243:Col11a1 UTSW 3 113,855,141 (GRCm39) missense unknown
R8324:Col11a1 UTSW 3 113,958,059 (GRCm39) missense probably damaging 1.00
R8346:Col11a1 UTSW 3 114,005,818 (GRCm39) missense unknown
R8480:Col11a1 UTSW 3 113,975,043 (GRCm39) missense probably benign 0.04
R9113:Col11a1 UTSW 3 113,888,192 (GRCm39) nonsense probably null
R9122:Col11a1 UTSW 3 113,907,249 (GRCm39) missense unknown
R9137:Col11a1 UTSW 3 113,855,172 (GRCm39) missense unknown
R9224:Col11a1 UTSW 3 114,001,929 (GRCm39) missense unknown
R9264:Col11a1 UTSW 3 114,005,809 (GRCm39) missense unknown
R9272:Col11a1 UTSW 3 113,901,948 (GRCm39) nonsense probably null
R9382:Col11a1 UTSW 3 113,899,046 (GRCm39) missense unknown
R9492:Col11a1 UTSW 3 114,005,752 (GRCm39) missense probably benign 0.39
RF002:Col11a1 UTSW 3 114,010,650 (GRCm39) missense unknown
X0018:Col11a1 UTSW 3 113,905,882 (GRCm39) unclassified probably benign
Z1177:Col11a1 UTSW 3 113,958,884 (GRCm39) critical splice acceptor site probably null
Z1177:Col11a1 UTSW 3 113,932,570 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- GCTCAGATCAGATAGTTAACAAAGG -3'
(R):5'- AGAATTAGCCCCATTGCCATC -3'

Sequencing Primer
(F):5'- ACAGTCTCGAAAAGGCTA -3'
(R):5'- TCTGTCTGTGCCTCCAGTAG -3'
Posted On 2020-06-30