Incidental Mutation 'R8134:Casz1'
ID 632153
Institutional Source Beutler Lab
Gene Symbol Casz1
Ensembl Gene ENSMUSG00000028977
Gene Name castor zinc finger 1
Synonyms D4Ertd432e, Cst, castor, 2410019P08Rik
MMRRC Submission 067562-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8134 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 148888886-149039346 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 149027492 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 1005 (P1005S)
Ref Sequence ENSEMBL: ENSMUSP00000092035 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094464] [ENSMUST00000122222] [ENSMUST00000139806]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000094464
AA Change: P1005S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092035
Gene: ENSMUSG00000028977
AA Change: P1005S

DomainStartEndE-ValueType
low complexity region 403 420 N/A INTRINSIC
ZnF_C2H2 489 514 5.34e0 SMART
ZnF_C2H2 550 574 8.09e-1 SMART
ZnF_C2H2 609 633 9.3e-1 SMART
low complexity region 643 658 N/A INTRINSIC
ZnF_C2H2 667 691 1.1e-2 SMART
low complexity region 698 711 N/A INTRINSIC
low complexity region 728 766 N/A INTRINSIC
low complexity region 796 807 N/A INTRINSIC
low complexity region 810 834 N/A INTRINSIC
low complexity region 875 890 N/A INTRINSIC
low complexity region 951 957 N/A INTRINSIC
ZnF_C2H2 1031 1055 2.29e1 SMART
low complexity region 1080 1091 N/A INTRINSIC
low complexity region 1105 1115 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122222
AA Change: P1005S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000112978
Gene: ENSMUSG00000028977
AA Change: P1005S

DomainStartEndE-ValueType
low complexity region 403 420 N/A INTRINSIC
ZnF_C2H2 489 514 5.34e0 SMART
ZnF_C2H2 550 574 8.09e-1 SMART
ZnF_C2H2 609 633 9.3e-1 SMART
low complexity region 643 658 N/A INTRINSIC
ZnF_C2H2 667 691 1.1e-2 SMART
low complexity region 698 711 N/A INTRINSIC
low complexity region 728 766 N/A INTRINSIC
low complexity region 796 807 N/A INTRINSIC
low complexity region 810 834 N/A INTRINSIC
low complexity region 875 890 N/A INTRINSIC
low complexity region 951 957 N/A INTRINSIC
ZnF_C2H2 1031 1055 2.29e1 SMART
low complexity region 1080 1091 N/A INTRINSIC
low complexity region 1105 1115 N/A INTRINSIC
ZnF_C2H2 1182 1206 1.59e1 SMART
ZnF_C2H2 1242 1266 2.47e1 SMART
ZnF_C2H2 1300 1324 3.47e0 SMART
ZnF_C2H2 1457 1481 7.89e0 SMART
ZnF_C2H2 1515 1537 3.21e1 SMART
ZnF_C2H2 1571 1595 3.99e0 SMART
low complexity region 1632 1649 N/A INTRINSIC
SCOP:d1qbkb_ 1675 1742 2e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139806
SMART Domains Protein: ENSMUSP00000120307
Gene: ENSMUSG00000028977

DomainStartEndE-ValueType
low complexity region 117 134 N/A INTRINSIC
ZnF_C2H2 203 228 5.34e0 SMART
ZnF_C2H2 264 288 8.09e-1 SMART
ZnF_C2H2 323 347 9.3e-1 SMART
low complexity region 357 372 N/A INTRINSIC
ZnF_C2H2 381 405 1.1e-2 SMART
low complexity region 412 425 N/A INTRINSIC
low complexity region 442 480 N/A INTRINSIC
low complexity region 510 521 N/A INTRINSIC
low complexity region 524 548 N/A INTRINSIC
low complexity region 589 604 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.5%
  • 20x: 93.5%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcription factor. The encoded protein may function as a tumor suppressor, and single nucleotide polymorphisms in this gene are associated with blood pressure variation. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete lethality throughout fetal growth and development and abnormal heart development associated with edema, decreased fetal cardiomyocyte proliferation, myocardium hypoplasia, ventricular septal defect, and altered heart shape and Z line formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abce1 G A 8: 80,425,982 (GRCm39) P265L probably benign Het
Adam20 A G 8: 41,249,101 (GRCm39) T404A probably benign Het
Anp32a G T 9: 62,284,863 (GRCm39) R237L unknown Het
Ascc3 A G 10: 50,643,554 (GRCm39) D1835G probably benign Het
Atg9b A G 5: 24,590,220 (GRCm39) probably null Het
Bard1 A T 1: 71,106,297 (GRCm39) N443K probably damaging Het
Btnl1 A G 17: 34,604,647 (GRCm39) D476G possibly damaging Het
C2cd3 A T 7: 100,067,711 (GRCm39) I487F Het
Cadm4 A G 7: 24,203,030 (GRCm39) E384G possibly damaging Het
Camsap3 A G 8: 3,648,075 (GRCm39) K128E probably benign Het
Cd38 C A 5: 44,058,790 (GRCm39) L135M probably damaging Het
Cdk20 A G 13: 64,585,734 (GRCm39) E244G probably benign Het
Cfap54 A T 10: 92,714,378 (GRCm39) V2667D unknown Het
Col11a1 A G 3: 114,012,435 (GRCm39) K1792E unknown Het
Cpne9 A T 6: 113,272,003 (GRCm39) D377V probably benign Het
Csmd1 A T 8: 15,982,550 (GRCm39) C2706S probably damaging Het
Ctnnbl1 T C 2: 157,651,391 (GRCm39) V222A probably benign Het
Frmpd2 T C 14: 33,227,452 (GRCm39) S277P probably benign Het
Herc2 C T 7: 55,734,884 (GRCm39) T158I probably benign Het
Hoxa4 G T 6: 52,167,537 (GRCm39) H215N possibly damaging Het
Hpd G T 5: 123,312,443 (GRCm39) Q309K probably benign Het
Il20ra A G 10: 19,626,452 (GRCm39) T159A probably damaging Het
Ints10 T A 8: 69,255,638 (GRCm39) Y209* probably null Het
Ints2 A G 11: 86,103,486 (GRCm39) I1190T probably damaging Het
Jhy A G 9: 40,872,188 (GRCm39) V107A probably null Het
Kdm4d C T 9: 14,374,532 (GRCm39) R442H probably damaging Het
Kifbp T C 10: 62,413,756 (GRCm39) Y134C probably benign Het
Klb A T 5: 65,540,958 (GRCm39) H1017L probably benign Het
Kndc1 T A 7: 139,481,285 (GRCm39) probably null Het
Krtap4-1 GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC 11: 99,518,660 (GRCm39) probably benign Het
Lrrn3 T C 12: 41,503,047 (GRCm39) I423M probably damaging Het
Magi2 T G 5: 20,596,365 (GRCm39) F274L probably damaging Het
Magi2 T A 5: 20,596,392 (GRCm39) D283E probably benign Het
Map3k19 A C 1: 127,751,492 (GRCm39) S620A probably damaging Het
Meis2 C T 2: 115,697,369 (GRCm39) M388I probably benign Het
Ms4a3 G C 19: 11,615,613 (GRCm39) H54Q probably benign Het
Nfe2l1 A T 11: 96,710,585 (GRCm39) M548K possibly damaging Het
Ninl C T 2: 150,792,234 (GRCm39) C763Y probably benign Het
Numa1 T C 7: 101,650,834 (GRCm39) F1522L probably benign Het
Or13a25 T A 7: 140,247,680 (GRCm39) I153N possibly damaging Het
Or2bd2 T C 7: 6,441,922 (GRCm39) probably benign Het
Pcdhgc3 G A 18: 37,939,916 (GRCm39) V106I probably benign Het
Phf3 A G 1: 30,863,552 (GRCm39) V152A unknown Het
Pira1 A G 7: 3,738,838 (GRCm39) S590P probably damaging Het
Plcg2 A T 8: 118,284,057 (GRCm39) D118V probably damaging Het
Pnpla1 A G 17: 29,097,443 (GRCm39) D203G probably damaging Het
Ppip5k2 A T 1: 97,672,888 (GRCm39) M474K probably benign Het
Ppp1r12b T C 1: 134,814,280 (GRCm39) E341G possibly damaging Het
Rictor C T 15: 6,801,635 (GRCm39) S441L probably benign Het
Rrs1 C T 1: 9,615,645 (GRCm39) probably benign Het
Scaf11 T C 15: 96,318,592 (GRCm39) N324S probably damaging Het
Spaca1 T A 4: 34,042,157 (GRCm39) probably null Het
Sun3 G T 11: 8,979,346 (GRCm39) D118E probably benign Het
Svop C T 5: 114,180,992 (GRCm39) V215I probably benign Het
Tbc1d15 A T 10: 115,045,474 (GRCm39) C497S probably damaging Het
Tdrd6 A T 17: 43,937,064 (GRCm39) I1328N probably damaging Het
Tuba8 T A 6: 121,198,381 (GRCm39) D116E probably benign Het
Ube2z A G 11: 95,949,200 (GRCm39) I213T possibly damaging Het
Ubqln4 G A 3: 88,462,797 (GRCm39) probably null Het
Vps13a A G 19: 16,631,718 (GRCm39) I2639T possibly damaging Het
Zfp217 G A 2: 169,961,571 (GRCm39) S252F possibly damaging Het
Zfp94 A T 7: 24,003,166 (GRCm39) V92E probably benign Het
Other mutations in Casz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00914:Casz1 APN 4 149,013,828 (GRCm39) missense probably damaging 1.00
IGL02137:Casz1 APN 4 149,017,925 (GRCm39) missense possibly damaging 0.71
IGL02176:Casz1 APN 4 149,019,076 (GRCm39) missense probably damaging 1.00
IGL02629:Casz1 APN 4 149,028,848 (GRCm39) missense probably benign 0.01
IGL02871:Casz1 APN 4 149,028,776 (GRCm39) missense possibly damaging 0.93
FR4340:Casz1 UTSW 4 149,036,759 (GRCm39) small deletion probably benign
G1Funyon:Casz1 UTSW 4 149,030,500 (GRCm39) missense probably damaging 0.98
H8562:Casz1 UTSW 4 149,017,908 (GRCm39) missense probably damaging 1.00
R0090:Casz1 UTSW 4 149,017,868 (GRCm39) missense probably benign 0.00
R0389:Casz1 UTSW 4 149,033,368 (GRCm39) missense possibly damaging 0.83
R0443:Casz1 UTSW 4 149,033,368 (GRCm39) missense possibly damaging 0.83
R0550:Casz1 UTSW 4 149,036,741 (GRCm39) small deletion probably benign
R0597:Casz1 UTSW 4 149,028,851 (GRCm39) missense probably benign 0.00
R1117:Casz1 UTSW 4 149,019,052 (GRCm39) missense probably damaging 1.00
R1476:Casz1 UTSW 4 149,030,628 (GRCm39) missense probably benign 0.05
R1540:Casz1 UTSW 4 149,027,357 (GRCm39) unclassified probably benign
R1610:Casz1 UTSW 4 149,013,544 (GRCm39) missense possibly damaging 0.54
R1764:Casz1 UTSW 4 149,027,357 (GRCm39) unclassified probably benign
R1779:Casz1 UTSW 4 149,017,394 (GRCm39) missense probably benign 0.00
R1874:Casz1 UTSW 4 149,027,668 (GRCm39) missense probably damaging 0.99
R1902:Casz1 UTSW 4 149,020,652 (GRCm39) missense possibly damaging 0.95
R1914:Casz1 UTSW 4 149,017,415 (GRCm39) missense probably damaging 1.00
R2126:Casz1 UTSW 4 149,030,521 (GRCm39) missense probably damaging 0.99
R2261:Casz1 UTSW 4 149,013,556 (GRCm39) missense probably damaging 0.96
R2262:Casz1 UTSW 4 149,013,556 (GRCm39) missense probably damaging 0.96
R3874:Casz1 UTSW 4 149,024,046 (GRCm39) intron probably benign
R4019:Casz1 UTSW 4 149,017,335 (GRCm39) missense probably benign 0.00
R4355:Casz1 UTSW 4 149,036,792 (GRCm39) missense unknown
R4420:Casz1 UTSW 4 149,033,375 (GRCm39) missense possibly damaging 0.90
R4610:Casz1 UTSW 4 149,017,724 (GRCm39) missense probably damaging 1.00
R4632:Casz1 UTSW 4 149,036,312 (GRCm39) missense possibly damaging 0.71
R4762:Casz1 UTSW 4 149,023,438 (GRCm39) missense probably damaging 1.00
R4824:Casz1 UTSW 4 149,029,028 (GRCm39) missense probably damaging 1.00
R4907:Casz1 UTSW 4 149,028,998 (GRCm39) missense probably damaging 1.00
R5628:Casz1 UTSW 4 149,030,553 (GRCm39) missense probably damaging 1.00
R5736:Casz1 UTSW 4 149,013,867 (GRCm39) missense probably benign 0.00
R5929:Casz1 UTSW 4 149,023,426 (GRCm39) missense probably damaging 1.00
R5929:Casz1 UTSW 4 149,023,153 (GRCm39) missense probably damaging 1.00
R5932:Casz1 UTSW 4 149,023,570 (GRCm39) missense possibly damaging 0.52
R6016:Casz1 UTSW 4 149,019,041 (GRCm39) missense probably damaging 1.00
R6019:Casz1 UTSW 4 149,031,495 (GRCm39) missense probably damaging 0.99
R6139:Casz1 UTSW 4 149,036,154 (GRCm39) missense probably damaging 1.00
R6223:Casz1 UTSW 4 149,017,840 (GRCm39) missense probably damaging 1.00
R6239:Casz1 UTSW 4 149,022,734 (GRCm39) missense probably damaging 1.00
R6323:Casz1 UTSW 4 149,026,161 (GRCm39) missense possibly damaging 0.89
R6354:Casz1 UTSW 4 149,036,999 (GRCm39) missense unknown
R6454:Casz1 UTSW 4 149,035,952 (GRCm39) missense probably damaging 0.99
R6479:Casz1 UTSW 4 149,021,535 (GRCm39) missense probably damaging 1.00
R6529:Casz1 UTSW 4 149,022,646 (GRCm39) missense probably damaging 1.00
R6772:Casz1 UTSW 4 149,027,663 (GRCm39) missense probably damaging 1.00
R7000:Casz1 UTSW 4 149,013,693 (GRCm39) missense probably damaging 1.00
R7152:Casz1 UTSW 4 148,985,748 (GRCm39) start gained probably benign
R7324:Casz1 UTSW 4 149,031,490 (GRCm39) missense probably damaging 0.99
R7339:Casz1 UTSW 4 149,036,202 (GRCm39) missense probably damaging 1.00
R7388:Casz1 UTSW 4 149,036,850 (GRCm39) missense unknown
R7480:Casz1 UTSW 4 149,029,043 (GRCm39) missense probably damaging 0.99
R7719:Casz1 UTSW 4 149,028,981 (GRCm39) missense probably damaging 0.99
R7789:Casz1 UTSW 4 149,013,863 (GRCm39) missense probably benign
R7801:Casz1 UTSW 4 149,022,706 (GRCm39) missense probably damaging 0.99
R7815:Casz1 UTSW 4 149,013,762 (GRCm39) missense possibly damaging 0.89
R7818:Casz1 UTSW 4 149,030,533 (GRCm39) missense probably damaging 1.00
R7938:Casz1 UTSW 4 149,028,943 (GRCm39) missense probably benign 0.05
R8045:Casz1 UTSW 4 149,017,236 (GRCm39) missense probably damaging 1.00
R8165:Casz1 UTSW 4 149,028,888 (GRCm39) missense probably damaging 1.00
R8301:Casz1 UTSW 4 149,030,500 (GRCm39) missense probably damaging 0.98
R8419:Casz1 UTSW 4 149,033,040 (GRCm39) missense probably benign 0.29
R9047:Casz1 UTSW 4 149,023,497 (GRCm39) missense probably damaging 1.00
R9420:Casz1 UTSW 4 149,023,320 (GRCm39) missense probably damaging 0.99
R9584:Casz1 UTSW 4 148,985,704 (GRCm39) start gained probably benign
RF001:Casz1 UTSW 4 149,036,761 (GRCm39) small deletion probably benign
RF063:Casz1 UTSW 4 149,036,761 (GRCm39) small deletion probably benign
X0018:Casz1 UTSW 4 149,023,465 (GRCm39) missense probably damaging 1.00
X0064:Casz1 UTSW 4 149,017,409 (GRCm39) missense probably damaging 0.99
Z1088:Casz1 UTSW 4 149,028,816 (GRCm39) missense probably benign
Z1176:Casz1 UTSW 4 149,028,816 (GRCm39) missense probably benign
Z1177:Casz1 UTSW 4 149,028,816 (GRCm39) missense probably benign
Z1177:Casz1 UTSW 4 149,017,763 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCCTCCTTTCTAGCCAAG -3'
(R):5'- TGGGCATCACAGAAGTCCTTG -3'

Sequencing Primer
(F):5'- CAAGGCTAAAGAGGGTGTGTGTTC -3'
(R):5'- GCATCACAGAAGTCCTTGGTACC -3'
Posted On 2020-06-30