Incidental Mutation 'R8134:Tuba8'
ID632163
Institutional Source Beutler Lab
Gene Symbol Tuba8
Ensembl Gene ENSMUSG00000030137
Gene Nametubulin, alpha 8
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8134 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location121210696-121226854 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 121221422 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 116 (D116E)
Ref Sequence ENSEMBL: ENSMUSP00000032233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032233]
Predicted Effect probably benign
Transcript: ENSMUST00000032233
AA Change: D116E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000032233
Gene: ENSMUSG00000030137
AA Change: D116E

DomainStartEndE-ValueType
Tubulin 49 246 2.17e-79 SMART
Tubulin_C 248 393 3.76e-56 SMART
low complexity region 441 448 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.5%
  • 20x: 93.5%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: This gene encodes a member of the tubulin family of cytoskeletal proteins that form the integral component of microtubules. This gene is preferentially expressed in heart, skeletal muscle and testis. The encoded protein may play a role in liver tumorigenesis in mice. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele appear neurologically normal, progress to adulthood and exhibit normal fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abce1 G A 8: 79,699,353 P265L probably benign Het
Adam20 A G 8: 40,796,064 T404A probably benign Het
Anp32a G T 9: 62,377,581 R237L unknown Het
Ascc3 A G 10: 50,767,458 D1835G probably benign Het
Atg9b A G 5: 24,385,222 probably null Het
Bard1 A T 1: 71,067,138 N443K probably damaging Het
Btnl1 A G 17: 34,385,673 D476G possibly damaging Het
C2cd3 A T 7: 100,418,504 I487F Het
Cadm4 A G 7: 24,503,605 E384G possibly damaging Het
Camsap3 A G 8: 3,598,075 K128E probably benign Het
Casz1 C T 4: 148,943,035 P1005S probably damaging Het
Cd38 C A 5: 43,901,448 L135M probably damaging Het
Cdk20 A G 13: 64,437,920 E244G probably benign Het
Cfap54 A T 10: 92,878,516 V2667D unknown Het
Col11a1 A G 3: 114,218,786 K1792E unknown Het
Cpne9 A T 6: 113,295,042 D377V probably benign Het
Csmd1 A T 8: 15,932,550 C2706S probably damaging Het
Ctnnbl1 T C 2: 157,809,471 V222A probably benign Het
Frmpd2 T C 14: 33,505,495 S277P probably benign Het
Gm15922 A G 7: 3,735,839 S590P probably damaging Het
Herc2 C T 7: 56,085,136 T158I probably benign Het
Hoxa4 G T 6: 52,190,557 H215N possibly damaging Het
Hpd G T 5: 123,174,380 Q309K probably benign Het
Il20ra A G 10: 19,750,704 T159A probably damaging Het
Ints10 T A 8: 68,802,986 Y209* probably null Het
Ints2 A G 11: 86,212,660 I1190T probably damaging Het
Jhy A G 9: 40,960,892 V107A probably null Het
Kdm4d C T 9: 14,463,236 R442H probably damaging Het
Kif1bp T C 10: 62,577,977 Y134C probably benign Het
Klb A T 5: 65,383,615 H1017L probably benign Het
Kndc1 T A 7: 139,901,369 probably null Het
Krtap4-1 GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC 11: 99,627,834 probably benign Het
Lrrn3 T C 12: 41,453,048 I423M probably damaging Het
Magi2 T G 5: 20,391,367 F274L probably damaging Het
Magi2 T A 5: 20,391,394 D283E probably benign Het
Map3k19 A C 1: 127,823,755 S620A probably damaging Het
Meis2 C T 2: 115,866,888 M388I probably benign Het
Ms4a3 G C 19: 11,638,249 H54Q probably benign Het
Nfe2l1 A T 11: 96,819,759 M548K possibly damaging Het
Ninl C T 2: 150,950,314 C763Y probably benign Het
Numa1 T C 7: 102,001,627 F1522L probably benign Het
Olfr1344 T C 7: 6,438,923 probably benign Het
Olfr539 T A 7: 140,667,767 I153N possibly damaging Het
Pcdhgc3 G A 18: 37,806,863 V106I probably benign Het
Phf3 A G 1: 30,824,471 V152A unknown Het
Plcg2 A T 8: 117,557,318 D118V probably damaging Het
Pnpla1 A G 17: 28,878,469 D203G probably damaging Het
Ppip5k2 A T 1: 97,745,163 M474K probably benign Het
Ppp1r12b T C 1: 134,886,542 E341G possibly damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rrs1 C T 1: 9,545,420 probably benign Het
Scaf11 T C 15: 96,420,711 N324S probably damaging Het
Spaca1 T A 4: 34,042,157 probably null Het
Sun3 G T 11: 9,029,346 D118E probably benign Het
Svop C T 5: 114,042,931 V215I probably benign Het
Tbc1d15 A T 10: 115,209,569 C497S probably damaging Het
Tdrd6 A T 17: 43,626,173 I1328N probably damaging Het
Ube2z A G 11: 96,058,374 I213T possibly damaging Het
Ubqln4 G A 3: 88,555,490 probably null Het
Vps13a A G 19: 16,654,354 I2639T possibly damaging Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zfp94 A T 7: 24,303,741 V92E probably benign Het
Other mutations in Tuba8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02043:Tuba8 APN 6 121220511 missense probably benign
IGL02725:Tuba8 APN 6 121225957 nonsense probably null
IGL03091:Tuba8 APN 6 121220444 missense probably damaging 1.00
IGL03286:Tuba8 APN 6 121222954 missense possibly damaging 0.67
R0032:Tuba8 UTSW 6 121225904 missense probably benign 0.37
R1424:Tuba8 UTSW 6 121220511 missense probably benign
R1624:Tuba8 UTSW 6 121220426 missense probably damaging 1.00
R1741:Tuba8 UTSW 6 121222768 missense possibly damaging 0.95
R1985:Tuba8 UTSW 6 121220520 missense probably benign 0.00
R2513:Tuba8 UTSW 6 121225973 missense probably damaging 1.00
R3160:Tuba8 UTSW 6 121222738 missense possibly damaging 0.80
R3162:Tuba8 UTSW 6 121222738 missense possibly damaging 0.80
R4074:Tuba8 UTSW 6 121222797 missense probably damaging 1.00
R4875:Tuba8 UTSW 6 121226083 utr 3 prime probably benign
R4968:Tuba8 UTSW 6 121220589 missense probably damaging 1.00
R5073:Tuba8 UTSW 6 121222903 missense probably damaging 0.99
R5444:Tuba8 UTSW 6 121226101 utr 3 prime probably benign
R5546:Tuba8 UTSW 6 121222913 nonsense probably null
R5594:Tuba8 UTSW 6 121225904 missense possibly damaging 0.82
R5619:Tuba8 UTSW 6 121225895 missense probably damaging 0.96
R7366:Tuba8 UTSW 6 121222912 missense probably damaging 1.00
R7489:Tuba8 UTSW 6 121226021 missense probably damaging 1.00
R7774:Tuba8 UTSW 6 121223389 missense probably damaging 0.99
R8046:Tuba8 UTSW 6 121222873 missense probably damaging 1.00
R8284:Tuba8 UTSW 6 121222777 missense probably damaging 1.00
Z1177:Tuba8 UTSW 6 121223339 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GAACGTCTCTCCTGGAAACC -3'
(R):5'- TGTTCCTTCTGAGACTTGAACAG -3'

Sequencing Primer
(F):5'- AAACCAGGATCCGAGGGTCC -3'
(R):5'- GATGAGGCCCTAGATTTGAACCTC -3'
Posted On2020-06-30