Mutagenetix > Incidental Mutation

Incidental Mutation 'R8134:C2cd3'

632168

Institutional Source

Beutler Lab

Gene Symbol

C2cd3

Ensembl Gene

ENSMUSG00000047248

Gene Name

C2 calcium-dependent domain containing 3

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8134 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

100372233-100470152 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 100418504 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 487 (I487F)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000051777] [ENSMUST00000098259] [ENSMUST00000133464]

AlphaFold

Q52KB6

Predicted Effect

probably damaging
Transcript: ENSMUST00000051777
AA Change: I865F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000062637
Gene: ENSMUSG00000047248
AA Change: I865F

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	406	417	N/A	INTRINSIC
C2	524	662	2.36e1	SMART
C2	790	899	3.73e0	SMART
C2	989	1129	1.47e1	SMART
C2	1182	1321	1.63e1	SMART
C2	1617	1724	1.43e-2	SMART
low complexity region	1892	1906	N/A	INTRINSIC
low complexity region	2037	2049	N/A	INTRINSIC
low complexity region	2110	2125	N/A	INTRINSIC
low complexity region	2180	2197	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000098259
AA Change: I865F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000095859
Gene: ENSMUSG00000047248
AA Change: I865F

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	406	417	N/A	INTRINSIC
C2	524	662	2.36e1	SMART
C2	790	899	3.73e0	SMART
C2	989	1129	1.47e1	SMART
C2	1182	1321	1.63e1	SMART
C2	1617	1724	1.43e-2	SMART
low complexity region	1892	1906	N/A	INTRINSIC
low complexity region	2037	2049	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000113360
Gene: ENSMUSG00000047248
AA Change: I487F

Domain	Start	End	E-Value	Type
C2	61	199	2.36e1	SMART
C2	327	436	3.73e0	SMART
C2	526	666	1.47e1	SMART
C2	719	858	1.63e1	SMART
C2	1154	1261	1.43e-2	SMART
low complexity region	1429	1443	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000133464

SMART Domains

Protein: ENSMUSP00000118864
Gene: ENSMUSG00000047248

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC

Coding Region Coverage

1x: 99.8%
3x: 99.6%
10x: 98.5%
20x: 93.5%

Validation Efficiency

99% (71/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions as a regulator of centriole elongation. Studies of the orthologous mouse protein show that it promotes centriolar distal appendage assembly and is also required for the recruitment of other ciliogenic proteins, including intraflagellar transport proteins. Mutations in this gene cause orofaciodigital syndrome XIV (OFD14), a ciliopathy resulting in malformations of the oral cavity, face and digits. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygotes inactivating allele are embryonic lethal with pericardial edema and twisted body axis, abnormal patterning of brain and open neural tube defect. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abce1	G	A	8: 79,699,353	P265L	probably benign	Het
Adam20	A	G	8: 40,796,064	T404A	probably benign	Het
Anp32a	G	T	9: 62,377,581	R237L	unknown	Het
Ascc3	A	G	10: 50,767,458	D1835G	probably benign	Het
Atg9b	A	G	5: 24,385,222		probably null	Het
Bard1	A	T	1: 71,067,138	N443K	probably damaging	Het
Btnl1	A	G	17: 34,385,673	D476G	possibly damaging	Het
Cadm4	A	G	7: 24,503,605	E384G	possibly damaging	Het
Camsap3	A	G	8: 3,598,075	K128E	probably benign	Het
Casz1	C	T	4: 148,943,035	P1005S	probably damaging	Het
Cd38	C	A	5: 43,901,448	L135M	probably damaging	Het
Cdk20	A	G	13: 64,437,920	E244G	probably benign	Het
Cfap54	A	T	10: 92,878,516	V2667D	unknown	Het
Col11a1	A	G	3: 114,218,786	K1792E	unknown	Het
Cpne9	A	T	6: 113,295,042	D377V	probably benign	Het
Csmd1	A	T	8: 15,932,550	C2706S	probably damaging	Het
Ctnnbl1	T	C	2: 157,809,471	V222A	probably benign	Het
Frmpd2	T	C	14: 33,505,495	S277P	probably benign	Het
Gm15922	A	G	7: 3,735,839	S590P	probably damaging	Het
Herc2	C	T	7: 56,085,136	T158I	probably benign	Het
Hoxa4	G	T	6: 52,190,557	H215N	possibly damaging	Het
Hpd	G	T	5: 123,174,380	Q309K	probably benign	Het
Il20ra	A	G	10: 19,750,704	T159A	probably damaging	Het
Ints10	T	A	8: 68,802,986	Y209*	probably null	Het
Ints2	A	G	11: 86,212,660	I1190T	probably damaging	Het
Jhy	A	G	9: 40,960,892	V107A	probably null	Het
Kdm4d	C	T	9: 14,463,236	R442H	probably damaging	Het
Kif1bp	T	C	10: 62,577,977	Y134C	probably benign	Het
Klb	A	T	5: 65,383,615	H1017L	probably benign	Het
Kndc1	T	A	7: 139,901,369		probably null	Het
Krtap4-1	GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC	GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC	11: 99,627,834		probably benign	Het
Lrrn3	T	C	12: 41,453,048	I423M	probably damaging	Het
Magi2	T	G	5: 20,391,367	F274L	probably damaging	Het
Magi2	T	A	5: 20,391,394	D283E	probably benign	Het
Map3k19	A	C	1: 127,823,755	S620A	probably damaging	Het
Meis2	C	T	2: 115,866,888	M388I	probably benign	Het
Ms4a3	G	C	19: 11,638,249	H54Q	probably benign	Het
Nfe2l1	A	T	11: 96,819,759	M548K	possibly damaging	Het
Ninl	C	T	2: 150,950,314	C763Y	probably benign	Het
Numa1	T	C	7: 102,001,627	F1522L	probably benign	Het
Olfr1344	T	C	7: 6,438,923		probably benign	Het
Olfr539	T	A	7: 140,667,767	I153N	possibly damaging	Het
Pcdhgc3	G	A	18: 37,806,863	V106I	probably benign	Het
Phf3	A	G	1: 30,824,471	V152A	unknown	Het
Plcg2	A	T	8: 117,557,318	D118V	probably damaging	Het
Pnpla1	A	G	17: 28,878,469	D203G	probably damaging	Het
Ppip5k2	A	T	1: 97,745,163	M474K	probably benign	Het
Ppp1r12b	T	C	1: 134,886,542	E341G	possibly damaging	Het
Rictor	C	T	15: 6,772,154	S441L	probably benign	Het
Rrs1	C	T	1: 9,545,420		probably benign	Het
Scaf11	T	C	15: 96,420,711	N324S	probably damaging	Het
Spaca1	T	A	4: 34,042,157		probably null	Het
Sun3	G	T	11: 9,029,346	D118E	probably benign	Het
Svop	C	T	5: 114,042,931	V215I	probably benign	Het
Tbc1d15	A	T	10: 115,209,569	C497S	probably damaging	Het
Tdrd6	A	T	17: 43,626,173	I1328N	probably damaging	Het
Tuba8	T	A	6: 121,221,422	D116E	probably benign	Het
Ube2z	A	G	11: 96,058,374	I213T	possibly damaging	Het
Ubqln4	G	A	3: 88,555,490		probably null	Het
Vps13a	A	G	19: 16,654,354	I2639T	possibly damaging	Het
Zfp217	G	A	2: 170,119,651	S252F	possibly damaging	Het
Zfp94	A	T	7: 24,303,741	V92E	probably benign	Het

Other mutations in C2cd3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00540:C2cd3	APN	7	100391128	missense	probably benign	0.14
IGL01420:C2cd3	APN	7	100454858	missense	probably benign	0.35
IGL01775:C2cd3	APN	7	100443431	missense	probably damaging	1.00
IGL01832:C2cd3	APN	7	100427214	missense	possibly damaging	0.94
IGL01883:C2cd3	APN	7	100374486	missense	possibly damaging	0.80
IGL02664:C2cd3	APN	7	100419715	missense	possibly damaging	0.67
IGL02697:C2cd3	APN	7	100427169	unclassified	probably benign
IGL02852:C2cd3	APN	7	100430189	missense	probably damaging	1.00
IGL03158:C2cd3	APN	7	100374476	missense	probably damaging	1.00
R0012:C2cd3	UTSW	7	100418522	missense	possibly damaging	0.52
R0012:C2cd3	UTSW	7	100418522	missense	possibly damaging	0.52
R0013:C2cd3	UTSW	7	100416062	missense	probably damaging	1.00
R0013:C2cd3	UTSW	7	100416062	missense	probably damaging	1.00
R0032:C2cd3	UTSW	7	100444445	unclassified	probably benign
R0032:C2cd3	UTSW	7	100444445	unclassified	probably benign
R0124:C2cd3	UTSW	7	100469518	missense	probably benign
R0387:C2cd3	UTSW	7	100422507	splice site	probably benign
R0522:C2cd3	UTSW	7	100395222	missense	probably benign	0.14
R1124:C2cd3	UTSW	7	100422681	missense	probably benign	0.00
R1484:C2cd3	UTSW	7	100440190	missense	probably damaging	1.00
R1533:C2cd3	UTSW	7	100406077	missense	possibly damaging	0.54
R1631:C2cd3	UTSW	7	100372497	critical splice donor site	probably null
R1875:C2cd3	UTSW	7	100407025	missense	possibly damaging	0.89
R2059:C2cd3	UTSW	7	100455493	unclassified	probably benign
R2060:C2cd3	UTSW	7	100454948	missense	probably damaging	1.00
R2348:C2cd3	UTSW	7	100413366	missense	probably damaging	1.00
R3103:C2cd3	UTSW	7	100395252	missense	possibly damaging	0.47
R3405:C2cd3	UTSW	7	100390166	missense	probably benign	0.01
R3687:C2cd3	UTSW	7	100435833	missense	probably benign	0.28
R3775:C2cd3	UTSW	7	100431998	missense	probably damaging	1.00
R3854:C2cd3	UTSW	7	100454601	critical splice acceptor site	probably null
R4359:C2cd3	UTSW	7	100441089	missense	probably damaging	1.00
R4403:C2cd3	UTSW	7	100432099	missense	probably damaging	1.00
R4446:C2cd3	UTSW	7	100374477	missense	probably damaging	1.00
R4646:C2cd3	UTSW	7	100372450	unclassified	probably benign
R4705:C2cd3	UTSW	7	100395188	missense	possibly damaging	0.77
R4770:C2cd3	UTSW	7	100443435	missense	probably damaging	1.00
R4777:C2cd3	UTSW	7	100416332	missense	possibly damaging	0.46
R4816:C2cd3	UTSW	7	100391019	missense	probably benign	0.01
R4842:C2cd3	UTSW	7	100416190	missense	probably benign	0.00
R4858:C2cd3	UTSW	7	100454953	missense	probably damaging	1.00
R4871:C2cd3	UTSW	7	100413374	missense	possibly damaging	0.79
R4898:C2cd3	UTSW	7	100405959	missense	probably damaging	1.00
R5026:C2cd3	UTSW	7	100459842	missense	possibly damaging	0.52
R5112:C2cd3	UTSW	7	100443485	missense	possibly damaging	0.91
R5242:C2cd3	UTSW	7	100390166	missense	probably benign	0.01
R5538:C2cd3	UTSW	7	100455493	critical splice donor site	probably null
R5861:C2cd3	UTSW	7	100444475	unclassified	probably benign
R6110:C2cd3	UTSW	7	100441076	missense	probably damaging	1.00
R6326:C2cd3	UTSW	7	100416428	missense	probably benign	0.02
R6429:C2cd3	UTSW	7	100432091	missense	probably damaging	1.00
R6610:C2cd3	UTSW	7	100455298	missense	probably benign
R6613:C2cd3	UTSW	7	100395241	missense	possibly damaging	0.87
R6631:C2cd3	UTSW	7	100418540	missense	probably damaging	1.00
R6787:C2cd3	UTSW	7	100455346	missense	probably benign
R6837:C2cd3	UTSW	7	100448746	missense	probably damaging	1.00
R6849:C2cd3	UTSW	7	100406927	missense	probably damaging	1.00
R6860:C2cd3	UTSW	7	100390241	missense	probably benign	0.28
R6929:C2cd3	UTSW	7	100451619	missense	probably damaging	1.00
R7026:C2cd3	UTSW	7	100432092	missense	probably damaging	1.00
R7088:C2cd3	UTSW	7	100416181	missense
R7174:C2cd3	UTSW	7	100432198	missense
R7241:C2cd3	UTSW	7	100407050	missense
R7335:C2cd3	UTSW	7	100422603	missense
R7357:C2cd3	UTSW	7	100430103	missense
R7493:C2cd3	UTSW	7	100427226	missense
R7567:C2cd3	UTSW	7	100430815	missense
R7573:C2cd3	UTSW	7	100419707	missense
R7869:C2cd3	UTSW	7	100469491	missense	probably damaging	0.99
R7999:C2cd3	UTSW	7	100459889	critical splice donor site	probably null
R8369:C2cd3	UTSW	7	100395258	missense	probably benign	0.03
R8372:C2cd3	UTSW	7	100455280	nonsense	probably null
R8753:C2cd3	UTSW	7	100399817	critical splice donor site	probably null
R8893:C2cd3	UTSW	7	100454797	missense	probably benign
R8905:C2cd3	UTSW	7	100424925	critical splice donor site	probably null
R8945:C2cd3	UTSW	7	100391079	missense	possibly damaging	0.88
R8970:C2cd3	UTSW	7	100419764	missense
R9000:C2cd3	UTSW	7	100416074	missense
R9064:C2cd3	UTSW	7	100410401	missense
R9072:C2cd3	UTSW	7	100391084	missense	probably benign	0.07
R9126:C2cd3	UTSW	7	100432223	missense
R9160:C2cd3	UTSW	7	100426029	missense
R9234:C2cd3	UTSW	7	100399805	missense
R9258:C2cd3	UTSW	7	100448819	missense
R9295:C2cd3	UTSW	7	100432527	missense
R9411:C2cd3	UTSW	7	100416497	missense
R9420:C2cd3	UTSW	7	100416055	missense
R9589:C2cd3	UTSW	7	100432549	missense
R9628:C2cd3	UTSW	7	100448754	missense
R9629:C2cd3	UTSW	7	100380042	missense	probably damaging	1.00
R9681:C2cd3	UTSW	7	100374455	missense	probably benign	0.32
R9775:C2cd3	UTSW	7	100427251	missense
X0002:C2cd3	UTSW	7	100440235	missense	possibly damaging	0.50

Predicted Primers

PCR Primer
(F):5'- TTAGAGAGAACCCATGCTGGC -3'
(R):5'- ATGCTGGCATATCTAAACCATGC -3'

Sequencing Primer
(F):5'- AGAGAACCCATGCTGGCTTGTATC -3'
(R):5'- GGCATATCTAAACCATGCATCTTCAG -3'

Posted On

2020-06-30