Mutagenetix > Incidental Mutation

Incidental Mutation 'R8134:Numa1'

632169

Institutional Source

Beutler Lab

Gene Symbol

Numa1

Ensembl Gene

ENSMUSG00000066306

Gene Name

nuclear mitotic apparatus protein 1

Synonyms

6720401E04Rik

MMRRC Submission

Accession Numbers

Genbank: NM_133947.3; Ensembl: ENSMUST00000084852

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8134 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

101934111-102014964 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 102001627 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 1522 (F1522L)

Ref Sequence

ENSEMBL: ENSMUSP00000081912 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084852] [ENSMUST00000163183] [ENSMUST00000209639] [ENSMUST00000210475]

AlphaFold

E9Q7G0

Predicted Effect

probably benign
Transcript: ENSMUST00000084852
AA Change: F1522L

PolyPhen 2 Score 0.136 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000081912
Gene: ENSMUSG00000066306
AA Change: F1522L

Domain	Start	End	E-Value	Type
low complexity region	187	201	N/A	INTRINSIC
coiled coil region	211	249	N/A	INTRINSIC
coiled coil region	274	818	N/A	INTRINSIC
low complexity region	856	869	N/A	INTRINSIC
internal_repeat_1	910	933	6.03e-6	PROSPERO
internal_repeat_2	911	951	2.35e-5	PROSPERO
low complexity region	979	992	N/A	INTRINSIC
low complexity region	1002	1018	N/A	INTRINSIC
low complexity region	1063	1081	N/A	INTRINSIC
internal_repeat_5	1094	1116	4.63e-5	PROSPERO
low complexity region	1130	1138	N/A	INTRINSIC
low complexity region	1220	1233	N/A	INTRINSIC
low complexity region	1271	1289	N/A	INTRINSIC
low complexity region	1364	1374	N/A	INTRINSIC
coiled coil region	1464	1681	N/A	INTRINSIC
low complexity region	1700	1711	N/A	INTRINSIC
internal_repeat_3	1718	1755	4.63e-5	PROSPERO
internal_repeat_4	1777	1819	4.63e-5	PROSPERO
internal_repeat_3	1800	1842	4.63e-5	PROSPERO
internal_repeat_4	1811	1854	4.63e-5	PROSPERO
low complexity region	1859	1875	N/A	INTRINSIC
PDB:3RO2\|B	1881	1908	3e-13	PDB
internal_repeat_2	1938	1977	2.35e-5	PROSPERO
internal_repeat_5	1973	1995	4.63e-5	PROSPERO
internal_repeat_1	2020	2043	6.03e-6	PROSPERO
low complexity region	2073	2085	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000163183
AA Change: F155L

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000126180
Gene: ENSMUSG00000066306
AA Change: F155L

Domain	Start	End	E-Value	Type
coiled coil region	7	73	N/A	INTRINSIC
low complexity region	150	160	N/A	INTRINSIC
SCOP:d1fxkc_	164	290	7e-3	SMART
low complexity region	347	358	N/A	INTRINSIC
low complexity region	506	522	N/A	INTRINSIC
PDB:3RO2\|B	528	555	2e-10	PDB
low complexity region	720	732	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000209639

Predicted Effect

probably benign
Transcript: ENSMUST00000210475

Coding Region Coverage

1x: 99.8%
3x: 99.6%
10x: 98.5%
20x: 93.5%

Validation Efficiency

99% (71/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein that forms a structural component of the nuclear matrix. The encoded protein interacts with microtubules and plays a role in the formation and organization of the mitotic spindle during cell division. Chromosomal translocation of this gene with the RARA (retinoic acid receptor, alpha) gene on chromosome 17 have been detected in patients with acute promyelocytic leukemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out or hypomorphic allele exhibit embryonic lethality by E9.5. [provided by MGI curators]

Allele List at MGI

All alleles(97) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(94)

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abce1	G	A	8: 79,699,353	P265L	probably benign	Het
Adam20	A	G	8: 40,796,064	T404A	probably benign	Het
Anp32a	G	T	9: 62,377,581	R237L	unknown	Het
Ascc3	A	G	10: 50,767,458	D1835G	probably benign	Het
Atg9b	A	G	5: 24,385,222		probably null	Het
Bard1	A	T	1: 71,067,138	N443K	probably damaging	Het
Btnl1	A	G	17: 34,385,673	D476G	possibly damaging	Het
C2cd3	A	T	7: 100,418,504	I487F		Het
Cadm4	A	G	7: 24,503,605	E384G	possibly damaging	Het
Camsap3	A	G	8: 3,598,075	K128E	probably benign	Het
Casz1	C	T	4: 148,943,035	P1005S	probably damaging	Het
Cd38	C	A	5: 43,901,448	L135M	probably damaging	Het
Cdk20	A	G	13: 64,437,920	E244G	probably benign	Het
Cfap54	A	T	10: 92,878,516	V2667D	unknown	Het
Col11a1	A	G	3: 114,218,786	K1792E	unknown	Het
Cpne9	A	T	6: 113,295,042	D377V	probably benign	Het
Csmd1	A	T	8: 15,932,550	C2706S	probably damaging	Het
Ctnnbl1	T	C	2: 157,809,471	V222A	probably benign	Het
Frmpd2	T	C	14: 33,505,495	S277P	probably benign	Het
Gm15922	A	G	7: 3,735,839	S590P	probably damaging	Het
Herc2	C	T	7: 56,085,136	T158I	probably benign	Het
Hoxa4	G	T	6: 52,190,557	H215N	possibly damaging	Het
Hpd	G	T	5: 123,174,380	Q309K	probably benign	Het
Il20ra	A	G	10: 19,750,704	T159A	probably damaging	Het
Ints10	T	A	8: 68,802,986	Y209*	probably null	Het
Ints2	A	G	11: 86,212,660	I1190T	probably damaging	Het
Jhy	A	G	9: 40,960,892	V107A	probably null	Het
Kdm4d	C	T	9: 14,463,236	R442H	probably damaging	Het
Kif1bp	T	C	10: 62,577,977	Y134C	probably benign	Het
Klb	A	T	5: 65,383,615	H1017L	probably benign	Het
Kndc1	T	A	7: 139,901,369		probably null	Het
Krtap4-1	GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC	GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC	11: 99,627,834		probably benign	Het
Lrrn3	T	C	12: 41,453,048	I423M	probably damaging	Het
Magi2	T	G	5: 20,391,367	F274L	probably damaging	Het
Magi2	T	A	5: 20,391,394	D283E	probably benign	Het
Map3k19	A	C	1: 127,823,755	S620A	probably damaging	Het
Meis2	C	T	2: 115,866,888	M388I	probably benign	Het
Ms4a3	G	C	19: 11,638,249	H54Q	probably benign	Het
Nfe2l1	A	T	11: 96,819,759	M548K	possibly damaging	Het
Ninl	C	T	2: 150,950,314	C763Y	probably benign	Het
Olfr1344	T	C	7: 6,438,923		probably benign	Het
Olfr539	T	A	7: 140,667,767	I153N	possibly damaging	Het
Pcdhgc3	G	A	18: 37,806,863	V106I	probably benign	Het
Phf3	A	G	1: 30,824,471	V152A	unknown	Het
Plcg2	A	T	8: 117,557,318	D118V	probably damaging	Het
Pnpla1	A	G	17: 28,878,469	D203G	probably damaging	Het
Ppip5k2	A	T	1: 97,745,163	M474K	probably benign	Het
Ppp1r12b	T	C	1: 134,886,542	E341G	possibly damaging	Het
Rictor	C	T	15: 6,772,154	S441L	probably benign	Het
Rrs1	C	T	1: 9,545,420		probably benign	Het
Scaf11	T	C	15: 96,420,711	N324S	probably damaging	Het
Spaca1	T	A	4: 34,042,157		probably null	Het
Sun3	G	T	11: 9,029,346	D118E	probably benign	Het
Svop	C	T	5: 114,042,931	V215I	probably benign	Het
Tbc1d15	A	T	10: 115,209,569	C497S	probably damaging	Het
Tdrd6	A	T	17: 43,626,173	I1328N	probably damaging	Het
Tuba8	T	A	6: 121,221,422	D116E	probably benign	Het
Ube2z	A	G	11: 96,058,374	I213T	possibly damaging	Het
Ubqln4	G	A	3: 88,555,490		probably null	Het
Vps13a	A	G	19: 16,654,354	I2639T	possibly damaging	Het
Zfp217	G	A	2: 170,119,651	S252F	possibly damaging	Het
Zfp94	A	T	7: 24,303,741	V92E	probably benign	Het

Other mutations in Numa1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00509:Numa1	APN	7	102013286	missense	possibly damaging	0.95
IGL00819:Numa1	APN	7	101992710	missense	possibly damaging	0.90
IGL01103:Numa1	APN	7	102001571	missense	probably benign	0.01
IGL01153:Numa1	APN	7	101994744	missense	probably damaging	1.00
IGL01954:Numa1	APN	7	101996093	nonsense	probably null
IGL02114:Numa1	APN	7	102011876	unclassified	probably benign
IGL02245:Numa1	APN	7	102000394	missense	probably benign	0.02
IGL02259:Numa1	APN	7	101987748	missense	possibly damaging	0.93
IGL02313:Numa1	APN	7	102000232	nonsense	probably null
IGL02316:Numa1	APN	7	102001370	missense	probably damaging	1.00
IGL02386:Numa1	APN	7	102007532	missense	probably benign	0.00
IGL02517:Numa1	APN	7	102012009	missense	probably benign	0.01
IGL02529:Numa1	APN	7	101999953	splice site	probably null
IGL02664:Numa1	APN	7	101998902	missense	possibly damaging	0.83
IGL02721:Numa1	APN	7	101999911	missense	probably benign	0.01
IGL02816:Numa1	APN	7	101996100	missense	probably damaging	1.00
IGL03126:Numa1	APN	7	102000667	nonsense	probably null
meltdown	UTSW	7	101990571	critical splice acceptor site	probably null
1mM(1):Numa1	UTSW	7	101994715	missense	probably benign	0.06
PIT4651001:Numa1	UTSW	7	102013934	missense	probably damaging	0.97
R0047:Numa1	UTSW	7	102009453	missense	probably damaging	1.00
R0047:Numa1	UTSW	7	102009453	missense	probably damaging	1.00
R0548:Numa1	UTSW	7	101995524	missense	possibly damaging	0.86
R0554:Numa1	UTSW	7	101995524	missense	possibly damaging	0.86
R0592:Numa1	UTSW	7	102013897	missense	probably benign
R0669:Numa1	UTSW	7	101999677	missense	probably benign
R0856:Numa1	UTSW	7	101998948	missense	probably damaging	1.00
R1072:Numa1	UTSW	7	102001150	splice site	probably null
R1776:Numa1	UTSW	7	102011050	missense	probably damaging	1.00
R1898:Numa1	UTSW	7	101992720	critical splice donor site	probably null
R1969:Numa1	UTSW	7	102009322	missense	probably damaging	0.98
R1970:Numa1	UTSW	7	102009322	missense	probably damaging	0.98
R1971:Numa1	UTSW	7	102009322	missense	probably damaging	0.98
R2180:Numa1	UTSW	7	101999990	missense	probably benign	0.00
R2256:Numa1	UTSW	7	102000791	missense	probably damaging	0.99
R2257:Numa1	UTSW	7	102000791	missense	probably damaging	0.99
R2508:Numa1	UTSW	7	101995524	missense	possibly damaging	0.86
R2958:Numa1	UTSW	7	102009495	missense	possibly damaging	0.92
R4210:Numa1	UTSW	7	102009738	missense	probably damaging	1.00
R4211:Numa1	UTSW	7	102009738	missense	probably damaging	1.00
R4643:Numa1	UTSW	7	102000665	splice site	probably null
R4783:Numa1	UTSW	7	102013566	missense	probably damaging	1.00
R4823:Numa1	UTSW	7	101996037	missense	probably damaging	1.00
R4908:Numa1	UTSW	7	102012805	missense	probably damaging	1.00
R4934:Numa1	UTSW	7	102010857	missense	probably benign	0.32
R4981:Numa1	UTSW	7	101992674	missense	probably damaging	1.00
R5120:Numa1	UTSW	7	101977437	missense	probably damaging	0.99
R5122:Numa1	UTSW	7	102013769	missense	probably damaging	1.00
R5210:Numa1	UTSW	7	101999981	missense	probably benign	0.03
R5230:Numa1	UTSW	7	101995524	missense	possibly damaging	0.86
R5547:Numa1	UTSW	7	102013930	missense	probably damaging	1.00
R5861:Numa1	UTSW	7	102009287	splice site	probably null
R6006:Numa1	UTSW	7	101992719	critical splice donor site	probably null
R6031:Numa1	UTSW	7	102012012	missense	possibly damaging	0.86
R6031:Numa1	UTSW	7	102012012	missense	possibly damaging	0.86
R6295:Numa1	UTSW	7	102000767	missense	probably benign	0.03
R6322:Numa1	UTSW	7	102000920	missense	probably damaging	1.00
R6413:Numa1	UTSW	7	101990571	critical splice acceptor site	probably null
R6786:Numa1	UTSW	7	101992638	missense	probably benign	0.05
R7218:Numa1	UTSW	7	102000910	missense	probably benign	0.02
R7312:Numa1	UTSW	7	101990599	missense	possibly damaging	0.92
R7374:Numa1	UTSW	7	102009128	missense	probably benign	0.00
R7626:Numa1	UTSW	7	101999423	missense	probably benign	0.42
R7769:Numa1	UTSW	7	101999000	missense	possibly damaging	0.77
R7830:Numa1	UTSW	7	101999285	missense	probably benign	0.03
R7886:Numa1	UTSW	7	102013865	missense	probably benign	0.27
R7935:Numa1	UTSW	7	102002331	missense	probably damaging	0.96
R8143:Numa1	UTSW	7	101999684	missense	possibly damaging	0.82
R8217:Numa1	UTSW	7	101992669	missense	possibly damaging	0.66
R8263:Numa1	UTSW	7	101999284	missense	probably benign	0.03
R8536:Numa1	UTSW	7	102001580	missense	probably damaging	0.96
R8677:Numa1	UTSW	7	102000941	missense	probably damaging	0.99
R8683:Numa1	UTSW	7	101977410	start codon destroyed	probably null	0.09
R8786:Numa1	UTSW	7	101998409	missense	probably benign	0.45
R8855:Numa1	UTSW	7	101990628	missense	possibly damaging	0.92
R8881:Numa1	UTSW	7	102001477	missense	probably benign	0.01
R9127:Numa1	UTSW	7	101992662	missense	possibly damaging	0.90
R9153:Numa1	UTSW	7	101999911	missense	probably benign	0.01
R9214:Numa1	UTSW	7	102000932	missense	probably damaging	0.99
R9294:Numa1	UTSW	7	101995416	missense	possibly damaging	0.77
R9294:Numa1	UTSW	7	102012796	missense	probably damaging	1.00
RF013:Numa1	UTSW	7	101999780	missense	probably damaging	0.99
Z1088:Numa1	UTSW	7	101998331	missense	probably damaging	0.99
Z1088:Numa1	UTSW	7	101998402	missense	probably benign	0.27

Predicted Primers

PCR Primer
(F):5'- CTGAGCATGCTGAAGAAGGC -3'
(R):5'- CACACAAACTTGGGATTCTACTAG -3'

Sequencing Primer
(F):5'- CCGGCAGTTTCTGGAAGTAGAAC -3'
(R):5'- GCAGGCTACTGCAGTATA -3'

Posted On

2020-06-30