Incidental Mutation 'R8134:Camsap3'
ID632171
Institutional Source Beutler Lab
Gene Symbol Camsap3
Ensembl Gene ENSMUSG00000044433
Gene Namecalmodulin regulated spectrin-associated protein family, member 3
SynonymsNezha, 2310057J16Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.907) question?
Stock #R8134 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location3587293-3609075 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3598075 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 128 (K128E)
Ref Sequence ENSEMBL: ENSMUSP00000146896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057028] [ENSMUST00000171962] [ENSMUST00000207077] [ENSMUST00000207432] [ENSMUST00000207533] [ENSMUST00000207712] [ENSMUST00000207970] [ENSMUST00000208036] [ENSMUST00000208240]
Predicted Effect probably benign
Transcript: ENSMUST00000057028
AA Change: K128E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000058958
Gene: ENSMUSG00000044433
AA Change: K128E

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
low complexity region 90 109 N/A INTRINSIC
Pfam:CH 166 315 5.5e-27 PFAM
Pfam:CAMSAP_CH 214 296 1.2e-29 PFAM
low complexity region 359 373 N/A INTRINSIC
coiled coil region 595 633 N/A INTRINSIC
low complexity region 645 655 N/A INTRINSIC
coiled coil region 696 727 N/A INTRINSIC
low complexity region 749 779 N/A INTRINSIC
low complexity region 828 837 N/A INTRINSIC
low complexity region 866 881 N/A INTRINSIC
coiled coil region 900 943 N/A INTRINSIC
low complexity region 944 965 N/A INTRINSIC
low complexity region 1002 1024 N/A INTRINSIC
CAMSAP_CKK 1111 1240 1.29e-86 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171962
AA Change: K128E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000125993
Gene: ENSMUSG00000044433
AA Change: K128E

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
low complexity region 90 109 N/A INTRINSIC
Pfam:CAMSAP_CH 214 296 6e-31 PFAM
low complexity region 360 374 N/A INTRINSIC
Pfam:CAMSAP_CC1 587 645 1.1e-27 PFAM
low complexity region 646 656 N/A INTRINSIC
coiled coil region 697 728 N/A INTRINSIC
low complexity region 750 780 N/A INTRINSIC
low complexity region 829 838 N/A INTRINSIC
low complexity region 867 882 N/A INTRINSIC
coiled coil region 901 944 N/A INTRINSIC
low complexity region 945 966 N/A INTRINSIC
low complexity region 1003 1025 N/A INTRINSIC
CAMSAP_CKK 1112 1241 1.29e-86 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207077
AA Change: K128E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000207432
AA Change: K128E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect unknown
Transcript: ENSMUST00000207533
AA Change: K128E
Predicted Effect unknown
Transcript: ENSMUST00000207712
AA Change: K128E
Predicted Effect probably benign
Transcript: ENSMUST00000207970
AA Change: K128E

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000208036
Predicted Effect unknown
Transcript: ENSMUST00000208240
AA Change: K128E
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.5%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display variable penetrance of vascular, liver, nervous system, rib and eye abnormalities. Mice homozygous for an allele with loss of microtubule binding show partial lethality, decreased body size and abnormal alignment of microtubles in polarized epithelial cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abce1 G A 8: 79,699,353 P265L probably benign Het
Adam20 A G 8: 40,796,064 T404A probably benign Het
Anp32a G T 9: 62,377,581 R237L unknown Het
Ascc3 A G 10: 50,767,458 D1835G probably benign Het
Atg9b A G 5: 24,385,222 probably null Het
Bard1 A T 1: 71,067,138 N443K probably damaging Het
Btnl1 A G 17: 34,385,673 D476G possibly damaging Het
C2cd3 A T 7: 100,418,504 I487F Het
Cadm4 A G 7: 24,503,605 E384G possibly damaging Het
Casz1 C T 4: 148,943,035 P1005S probably damaging Het
Cd38 C A 5: 43,901,448 L135M probably damaging Het
Cdk20 A G 13: 64,437,920 E244G probably benign Het
Cfap54 A T 10: 92,878,516 V2667D unknown Het
Col11a1 A G 3: 114,218,786 K1792E unknown Het
Cpne9 A T 6: 113,295,042 D377V probably benign Het
Csmd1 A T 8: 15,932,550 C2706S probably damaging Het
Ctnnbl1 T C 2: 157,809,471 V222A probably benign Het
Frmpd2 T C 14: 33,505,495 S277P probably benign Het
Gm15922 A G 7: 3,735,839 S590P probably damaging Het
Herc2 C T 7: 56,085,136 T158I probably benign Het
Hoxa4 G T 6: 52,190,557 H215N possibly damaging Het
Hpd G T 5: 123,174,380 Q309K probably benign Het
Il20ra A G 10: 19,750,704 T159A probably damaging Het
Ints10 T A 8: 68,802,986 Y209* probably null Het
Ints2 A G 11: 86,212,660 I1190T probably damaging Het
Jhy A G 9: 40,960,892 V107A probably null Het
Kdm4d C T 9: 14,463,236 R442H probably damaging Het
Kif1bp T C 10: 62,577,977 Y134C probably benign Het
Klb A T 5: 65,383,615 H1017L probably benign Het
Krtap4-1 GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC 11: 99,627,834 probably benign Het
Lrrn3 T C 12: 41,453,048 I423M probably damaging Het
Magi2 T G 5: 20,391,367 F274L probably damaging Het
Magi2 T A 5: 20,391,394 D283E probably benign Het
Map3k19 A C 1: 127,823,755 S620A probably damaging Het
Meis2 C T 2: 115,866,888 M388I probably benign Het
Ms4a3 G C 19: 11,638,249 H54Q probably benign Het
Nfe2l1 A T 11: 96,819,759 M548K possibly damaging Het
Ninl C T 2: 150,950,314 C763Y probably benign Het
Numa1 T C 7: 102,001,627 F1522L probably benign Het
Olfr539 T A 7: 140,667,767 I153N possibly damaging Het
Pcdhgc3 G A 18: 37,806,863 V106I probably benign Het
Plcg2 A T 8: 117,557,318 D118V probably damaging Het
Pnpla1 A G 17: 28,878,469 D203G probably damaging Het
Ppip5k2 A T 1: 97,745,163 M474K probably benign Het
Ppp1r12b T C 1: 134,886,542 E341G possibly damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rrs1 C T 1: 9,545,420 probably benign Het
Scaf11 T C 15: 96,420,711 N324S probably damaging Het
Sun3 G T 11: 9,029,346 D118E probably benign Het
Svop C T 5: 114,042,931 V215I probably benign Het
Tbc1d15 A T 10: 115,209,569 C497S probably damaging Het
Tdrd6 A T 17: 43,626,173 I1328N probably damaging Het
Tuba8 T A 6: 121,221,422 D116E probably benign Het
Ube2z A G 11: 96,058,374 I213T possibly damaging Het
Ubqln4 G A 3: 88,555,490 probably null Het
Vps13a A G 19: 16,654,354 I2639T possibly damaging Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zfp94 A T 7: 24,303,741 V92E probably benign Het
Other mutations in Camsap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Camsap3 APN 8 3602077 missense probably damaging 1.00
IGL00797:Camsap3 APN 8 3602115 splice site probably benign
IGL01457:Camsap3 APN 8 3604795 missense probably damaging 0.98
IGL01833:Camsap3 APN 8 3608508 missense probably damaging 1.00
IGL02095:Camsap3 APN 8 3603845 missense probably damaging 1.00
IGL02880:Camsap3 APN 8 3603913 missense probably damaging 1.00
R0005:Camsap3 UTSW 8 3604288 missense probably damaging 1.00
R0049:Camsap3 UTSW 8 3598772 missense probably benign 0.11
R0049:Camsap3 UTSW 8 3598772 missense probably benign 0.11
R0347:Camsap3 UTSW 8 3602029 missense probably damaging 1.00
R0926:Camsap3 UTSW 8 3587960 critical splice donor site probably null
R0946:Camsap3 UTSW 8 3604442 missense probably benign 0.00
R1169:Camsap3 UTSW 8 3603866 missense probably damaging 1.00
R1206:Camsap3 UTSW 8 3604708 missense probably damaging 1.00
R1207:Camsap3 UTSW 8 3604708 missense probably damaging 1.00
R1207:Camsap3 UTSW 8 3604708 missense probably damaging 1.00
R1454:Camsap3 UTSW 8 3603968 missense possibly damaging 0.58
R1475:Camsap3 UTSW 8 3604708 missense probably damaging 1.00
R1581:Camsap3 UTSW 8 3604708 missense probably damaging 1.00
R1618:Camsap3 UTSW 8 3598740 missense probably benign 0.25
R1820:Camsap3 UTSW 8 3603485 missense probably damaging 1.00
R1899:Camsap3 UTSW 8 3603922 nonsense probably null
R1914:Camsap3 UTSW 8 3604708 missense probably damaging 1.00
R1952:Camsap3 UTSW 8 3604789 missense probably damaging 0.99
R2338:Camsap3 UTSW 8 3606808 missense probably damaging 1.00
R3725:Camsap3 UTSW 8 3603785 missense probably damaging 1.00
R3726:Camsap3 UTSW 8 3603785 missense probably damaging 1.00
R4528:Camsap3 UTSW 8 3606515 missense possibly damaging 0.79
R4652:Camsap3 UTSW 8 3600689 missense possibly damaging 0.87
R5025:Camsap3 UTSW 8 3604244 missense probably damaging 1.00
R5120:Camsap3 UTSW 8 3600680 missense probably damaging 0.97
R5381:Camsap3 UTSW 8 3603812 missense probably damaging 1.00
R5388:Camsap3 UTSW 8 3604276 missense probably damaging 1.00
R5829:Camsap3 UTSW 8 3597899 missense probably damaging 1.00
R5846:Camsap3 UTSW 8 3603980 missense probably damaging 1.00
R5935:Camsap3 UTSW 8 3601999 missense probably damaging 1.00
R6363:Camsap3 UTSW 8 3601971 missense probably damaging 1.00
R6469:Camsap3 UTSW 8 3603941 missense possibly damaging 0.79
R6595:Camsap3 UTSW 8 3604186 missense probably damaging 1.00
R6595:Camsap3 UTSW 8 3608742 missense probably damaging 1.00
R7024:Camsap3 UTSW 8 3608242 missense probably damaging 0.98
R7062:Camsap3 UTSW 8 3607834 unclassified probably benign
R7109:Camsap3 UTSW 8 3598087 missense possibly damaging 0.53
R7233:Camsap3 UTSW 8 3600371 missense probably damaging 0.99
R7236:Camsap3 UTSW 8 3604116 missense probably damaging 1.00
R7316:Camsap3 UTSW 8 3604648 missense possibly damaging 0.51
R7340:Camsap3 UTSW 8 3587960 critical splice donor site probably null
R7512:Camsap3 UTSW 8 3598740 missense probably benign 0.25
R7779:Camsap3 UTSW 8 3597887 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCAGTACGCACAGGAGCAC -3'
(R):5'- AGGAGCTACACCTAATGGGC -3'

Sequencing Primer
(F):5'- CACAGGAGCACGTGAAGCC -3'
(R):5'- CTACACCTAATGGGCTGAGCTTGAG -3'
Posted On2020-06-30