Incidental Mutation 'R8134:Tbc1d15'
ID632184
Institutional Source Beutler Lab
Gene Symbol Tbc1d15
Ensembl Gene ENSMUSG00000020130
Gene NameTBC1 domain family, member 15
SynonymsLy6dl, 4432405K22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.325) question?
Stock #R8134 (G1)
Quality Score224.009
Status Validated
Chromosome10
Chromosomal Location115197872-115251467 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 115209569 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 497 (C497S)
Ref Sequence ENSEMBL: ENSMUSP00000020339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020339]
Predicted Effect probably damaging
Transcript: ENSMUST00000020339
AA Change: C497S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020339
Gene: ENSMUSG00000020130
AA Change: C497S

DomainStartEndE-ValueType
Pfam:DUF3548 6 224 1.3e-87 PFAM
TBC 326 564 1.14e-50 SMART
Blast:TBC 602 671 5e-23 BLAST
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.5%
  • 20x: 93.5%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras-like proteins in brain-GTPase activating protein superfamily that share a conserved Tre-2/Bub2/Cdc16 domain. The encoded protein interacts with Ras-like protein in brain 5A and may function as a regulator of intracellular trafficking. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2009]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abce1 G A 8: 79,699,353 P265L probably benign Het
Adam20 A G 8: 40,796,064 T404A probably benign Het
Anp32a G T 9: 62,377,581 R237L unknown Het
Ascc3 A G 10: 50,767,458 D1835G probably benign Het
Atg9b A G 5: 24,385,222 probably null Het
Bard1 A T 1: 71,067,138 N443K probably damaging Het
Btnl1 A G 17: 34,385,673 D476G possibly damaging Het
C2cd3 A T 7: 100,418,504 I487F Het
Cadm4 A G 7: 24,503,605 E384G possibly damaging Het
Camsap3 A G 8: 3,598,075 K128E probably benign Het
Casz1 C T 4: 148,943,035 P1005S probably damaging Het
Cd38 C A 5: 43,901,448 L135M probably damaging Het
Cdk20 A G 13: 64,437,920 E244G probably benign Het
Cfap54 A T 10: 92,878,516 V2667D unknown Het
Col11a1 A G 3: 114,218,786 K1792E unknown Het
Cpne9 A T 6: 113,295,042 D377V probably benign Het
Csmd1 A T 8: 15,932,550 C2706S probably damaging Het
Ctnnbl1 T C 2: 157,809,471 V222A probably benign Het
Frmpd2 T C 14: 33,505,495 S277P probably benign Het
Gm15922 A G 7: 3,735,839 S590P probably damaging Het
Herc2 C T 7: 56,085,136 T158I probably benign Het
Hoxa4 G T 6: 52,190,557 H215N possibly damaging Het
Hpd G T 5: 123,174,380 Q309K probably benign Het
Il20ra A G 10: 19,750,704 T159A probably damaging Het
Ints10 T A 8: 68,802,986 Y209* probably null Het
Ints2 A G 11: 86,212,660 I1190T probably damaging Het
Jhy A G 9: 40,960,892 V107A probably null Het
Kdm4d C T 9: 14,463,236 R442H probably damaging Het
Kif1bp T C 10: 62,577,977 Y134C probably benign Het
Klb A T 5: 65,383,615 H1017L probably benign Het
Kndc1 T A 7: 139,901,369 probably null Het
Krtap4-1 GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC 11: 99,627,834 probably benign Het
Lrrn3 T C 12: 41,453,048 I423M probably damaging Het
Magi2 T G 5: 20,391,367 F274L probably damaging Het
Magi2 T A 5: 20,391,394 D283E probably benign Het
Map3k19 A C 1: 127,823,755 S620A probably damaging Het
Meis2 C T 2: 115,866,888 M388I probably benign Het
Ms4a3 G C 19: 11,638,249 H54Q probably benign Het
Nfe2l1 A T 11: 96,819,759 M548K possibly damaging Het
Ninl C T 2: 150,950,314 C763Y probably benign Het
Numa1 T C 7: 102,001,627 F1522L probably benign Het
Olfr1344 T C 7: 6,438,923 probably benign Het
Olfr539 T A 7: 140,667,767 I153N possibly damaging Het
Pcdhgc3 G A 18: 37,806,863 V106I probably benign Het
Phf3 A G 1: 30,824,471 V152A unknown Het
Plcg2 A T 8: 117,557,318 D118V probably damaging Het
Pnpla1 A G 17: 28,878,469 D203G probably damaging Het
Ppip5k2 A T 1: 97,745,163 M474K probably benign Het
Ppp1r12b T C 1: 134,886,542 E341G possibly damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rrs1 C T 1: 9,545,420 probably benign Het
Scaf11 T C 15: 96,420,711 N324S probably damaging Het
Spaca1 T A 4: 34,042,157 probably null Het
Sun3 G T 11: 9,029,346 D118E probably benign Het
Svop C T 5: 114,042,931 V215I probably benign Het
Tdrd6 A T 17: 43,626,173 I1328N probably damaging Het
Tuba8 T A 6: 121,221,422 D116E probably benign Het
Ube2z A G 11: 96,058,374 I213T possibly damaging Het
Ubqln4 G A 3: 88,555,490 probably null Het
Vps13a A G 19: 16,654,354 I2639T possibly damaging Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zfp94 A T 7: 24,303,741 V92E probably benign Het
Other mutations in Tbc1d15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Tbc1d15 APN 10 115209641 nonsense probably null
IGL01161:Tbc1d15 APN 10 115202530 missense probably benign 0.01
IGL02458:Tbc1d15 APN 10 115229206 missense probably damaging 0.99
IGL03145:Tbc1d15 APN 10 115202516 missense probably benign 0.03
R0140:Tbc1d15 UTSW 10 115220219 missense probably damaging 0.99
R0466:Tbc1d15 UTSW 10 115219172 missense probably damaging 1.00
R0617:Tbc1d15 UTSW 10 115239299 missense probably damaging 1.00
R0633:Tbc1d15 UTSW 10 115220310 missense probably benign 0.00
R1526:Tbc1d15 UTSW 10 115203230 missense probably benign 0.38
R1699:Tbc1d15 UTSW 10 115220314 missense probably benign 0.05
R1727:Tbc1d15 UTSW 10 115210225 missense probably damaging 1.00
R2063:Tbc1d15 UTSW 10 115229173 missense probably benign
R2111:Tbc1d15 UTSW 10 115240914 missense possibly damaging 0.88
R4751:Tbc1d15 UTSW 10 115202587 missense probably damaging 1.00
R5318:Tbc1d15 UTSW 10 115208969 nonsense probably null
R5480:Tbc1d15 UTSW 10 115233218 missense probably damaging 1.00
R5746:Tbc1d15 UTSW 10 115210279 missense probably damaging 1.00
R5891:Tbc1d15 UTSW 10 115220308 missense probably benign 0.20
R6012:Tbc1d15 UTSW 10 115219207 missense probably damaging 1.00
R6306:Tbc1d15 UTSW 10 115233243 missense possibly damaging 0.91
R6989:Tbc1d15 UTSW 10 115209569 missense probably damaging 1.00
R7792:Tbc1d15 UTSW 10 115221587 missense possibly damaging 0.91
R8231:Tbc1d15 UTSW 10 115229140 missense probably damaging 1.00
R8507:Tbc1d15 UTSW 10 115202502 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACTCAGGCAACAGCAGTAG -3'
(R):5'- GAGGGCCAACACTTATCCTTAG -3'

Sequencing Primer
(F):5'- CTTAGAGAAGACCTGGGTTCAATCC -3'
(R):5'- GGCCAACACTTATCCTTAGATTATAC -3'
Posted On2020-06-30