Incidental Mutation 'R8134:Rictor'
ID 632193
Institutional Source Beutler Lab
Gene Symbol Rictor
Ensembl Gene ENSMUSG00000050310
Gene Name RPTOR independent companion of MTOR, complex 2
Synonyms D530039E11Rik, 4921505C17Rik, 6030405M08Rik
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8134 (G1)
Quality Score 168.009
Status Validated
Chromosome 15
Chromosomal Location 6708379-6800401 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 6772154 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Leucine at position 441 (S441L)
Ref Sequence ENSEMBL: ENSMUSP00000051809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061656]
AlphaFold Q6QI06
Predicted Effect probably benign
Transcript: ENSMUST00000061656
AA Change: S441L

PolyPhen 2 Score 0.272 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000051809
Gene: ENSMUSG00000050310
AA Change: S441L

DomainStartEndE-ValueType
RICTOR_N 57 439 4.02e-185 SMART
RICTOR_M 523 742 5.66e-98 SMART
RasGEF_N_2 743 857 1.26e-54 SMART
RICTOR_V 920 992 1.44e-40 SMART
low complexity region 1019 1043 N/A INTRINSIC
RICTOR_phospho 1084 1189 4.06e-58 SMART
low complexity region 1221 1239 N/A INTRINSIC
low complexity region 1255 1266 N/A INTRINSIC
low complexity region 1273 1287 N/A INTRINSIC
low complexity region 1404 1414 N/A INTRINSIC
low complexity region 1464 1474 N/A INTRINSIC
low complexity region 1616 1628 N/A INTRINSIC
Meta Mutation Damage Score 0.1015 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.5%
  • 20x: 93.5%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RICTOR and MTOR (FRAP1; MIM 601231) are components of a protein complex that integrates nutrient- and growth factor-derived signals to regulate cell growth (Sarbassov et al., 2004 [PubMed 15268862]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during organogenesis associated with abnormal placental morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abce1 G A 8: 79,699,353 P265L probably benign Het
Adam20 A G 8: 40,796,064 T404A probably benign Het
Anp32a G T 9: 62,377,581 R237L unknown Het
Ascc3 A G 10: 50,767,458 D1835G probably benign Het
Atg9b A G 5: 24,385,222 probably null Het
Bard1 A T 1: 71,067,138 N443K probably damaging Het
Btnl1 A G 17: 34,385,673 D476G possibly damaging Het
C2cd3 A T 7: 100,418,504 I487F Het
Cadm4 A G 7: 24,503,605 E384G possibly damaging Het
Camsap3 A G 8: 3,598,075 K128E probably benign Het
Casz1 C T 4: 148,943,035 P1005S probably damaging Het
Cd38 C A 5: 43,901,448 L135M probably damaging Het
Cdk20 A G 13: 64,437,920 E244G probably benign Het
Cfap54 A T 10: 92,878,516 V2667D unknown Het
Col11a1 A G 3: 114,218,786 K1792E unknown Het
Cpne9 A T 6: 113,295,042 D377V probably benign Het
Csmd1 A T 8: 15,932,550 C2706S probably damaging Het
Ctnnbl1 T C 2: 157,809,471 V222A probably benign Het
Frmpd2 T C 14: 33,505,495 S277P probably benign Het
Gm15922 A G 7: 3,735,839 S590P probably damaging Het
Herc2 C T 7: 56,085,136 T158I probably benign Het
Hoxa4 G T 6: 52,190,557 H215N possibly damaging Het
Hpd G T 5: 123,174,380 Q309K probably benign Het
Il20ra A G 10: 19,750,704 T159A probably damaging Het
Ints10 T A 8: 68,802,986 Y209* probably null Het
Ints2 A G 11: 86,212,660 I1190T probably damaging Het
Jhy A G 9: 40,960,892 V107A probably null Het
Kdm4d C T 9: 14,463,236 R442H probably damaging Het
Kif1bp T C 10: 62,577,977 Y134C probably benign Het
Klb A T 5: 65,383,615 H1017L probably benign Het
Kndc1 T A 7: 139,901,369 probably null Het
Krtap4-1 GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC 11: 99,627,834 probably benign Het
Lrrn3 T C 12: 41,453,048 I423M probably damaging Het
Magi2 T G 5: 20,391,367 F274L probably damaging Het
Magi2 T A 5: 20,391,394 D283E probably benign Het
Map3k19 A C 1: 127,823,755 S620A probably damaging Het
Meis2 C T 2: 115,866,888 M388I probably benign Het
Ms4a3 G C 19: 11,638,249 H54Q probably benign Het
Nfe2l1 A T 11: 96,819,759 M548K possibly damaging Het
Ninl C T 2: 150,950,314 C763Y probably benign Het
Numa1 T C 7: 102,001,627 F1522L probably benign Het
Olfr1344 T C 7: 6,438,923 probably benign Het
Olfr539 T A 7: 140,667,767 I153N possibly damaging Het
Pcdhgc3 G A 18: 37,806,863 V106I probably benign Het
Phf3 A G 1: 30,824,471 V152A unknown Het
Plcg2 A T 8: 117,557,318 D118V probably damaging Het
Pnpla1 A G 17: 28,878,469 D203G probably damaging Het
Ppip5k2 A T 1: 97,745,163 M474K probably benign Het
Ppp1r12b T C 1: 134,886,542 E341G possibly damaging Het
Rrs1 C T 1: 9,545,420 probably benign Het
Scaf11 T C 15: 96,420,711 N324S probably damaging Het
Spaca1 T A 4: 34,042,157 probably null Het
Sun3 G T 11: 9,029,346 D118E probably benign Het
Svop C T 5: 114,042,931 V215I probably benign Het
Tbc1d15 A T 10: 115,209,569 C497S probably damaging Het
Tdrd6 A T 17: 43,626,173 I1328N probably damaging Het
Tuba8 T A 6: 121,221,422 D116E probably benign Het
Ube2z A G 11: 96,058,374 I213T possibly damaging Het
Ubqln4 G A 3: 88,555,490 probably null Het
Vps13a A G 19: 16,654,354 I2639T possibly damaging Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zfp94 A T 7: 24,303,741 V92E probably benign Het
Other mutations in Rictor
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Rictor APN 15 6786590 missense probably damaging 0.99
IGL00785:Rictor APN 15 6776950 missense probably damaging 1.00
IGL00801:Rictor APN 15 6794534 missense probably damaging 1.00
IGL01072:Rictor APN 15 6789562 missense probably damaging 0.98
IGL01139:Rictor APN 15 6778268 missense probably damaging 1.00
IGL01303:Rictor APN 15 6708638 missense probably benign 0.10
IGL01307:Rictor APN 15 6774604 splice site probably null
IGL01767:Rictor APN 15 6777384 missense probably damaging 1.00
IGL01774:Rictor APN 15 6769777 missense probably damaging 1.00
IGL01800:Rictor APN 15 6774701 missense probably damaging 0.99
IGL02192:Rictor APN 15 6786414 missense probably benign 0.00
IGL02503:Rictor APN 15 6786443 missense probably benign 0.06
IGL02652:Rictor APN 15 6776187 critical splice donor site probably null
IGL02656:Rictor APN 15 6776920 missense probably damaging 0.98
IGL02752:Rictor APN 15 6787371 missense probably benign 0.02
IGL03000:Rictor APN 15 6769240 splice site probably benign
IGL03118:Rictor APN 15 6759518 missense possibly damaging 0.93
IGL03182:Rictor APN 15 6789598 missense probably benign 0.08
Tense UTSW 15 6759496 missense possibly damaging 0.94
Tonus UTSW 15 6769334 critical splice donor site probably null
Torrid UTSW 15 6759572 missense probably damaging 1.00
R0149:Rictor UTSW 15 6784107 missense possibly damaging 0.76
R0288:Rictor UTSW 15 6786540 missense probably benign 0.08
R0304:Rictor UTSW 15 6786371 splice site probably null
R0336:Rictor UTSW 15 6776753 critical splice acceptor site probably null
R0361:Rictor UTSW 15 6784107 missense possibly damaging 0.76
R0423:Rictor UTSW 15 6773900 missense possibly damaging 0.77
R0453:Rictor UTSW 15 6708642 missense probably benign 0.01
R0515:Rictor UTSW 15 6769301 missense probably damaging 1.00
R0630:Rictor UTSW 15 6794492 missense probably damaging 1.00
R0730:Rictor UTSW 15 6773986 splice site probably benign
R0744:Rictor UTSW 15 6764278 critical splice acceptor site probably null
R0836:Rictor UTSW 15 6764278 critical splice acceptor site probably null
R0881:Rictor UTSW 15 6791670 missense probably benign
R1114:Rictor UTSW 15 6794005 nonsense probably null
R1367:Rictor UTSW 15 6790638 splice site probably benign
R1655:Rictor UTSW 15 6772212 missense probably benign 0.00
R1678:Rictor UTSW 15 6756471 missense probably benign 0.07
R1679:Rictor UTSW 15 6768090 missense possibly damaging 0.92
R1754:Rictor UTSW 15 6735368 missense probably damaging 1.00
R1757:Rictor UTSW 15 6773862 missense possibly damaging 0.95
R1762:Rictor UTSW 15 6756573 missense probably benign 0.00
R1914:Rictor UTSW 15 6759572 missense probably damaging 1.00
R1915:Rictor UTSW 15 6759572 missense probably damaging 1.00
R1994:Rictor UTSW 15 6776156 missense probably benign 0.18
R2145:Rictor UTSW 15 6765107 missense probably damaging 1.00
R2182:Rictor UTSW 15 6772204 missense probably damaging 0.96
R2191:Rictor UTSW 15 6759614 missense probably benign 0.04
R2357:Rictor UTSW 15 6783562 missense probably damaging 0.99
R2914:Rictor UTSW 15 6769995 critical splice donor site probably null
R3082:Rictor UTSW 15 6774857 missense probably benign 0.15
R3885:Rictor UTSW 15 6759610 missense probably damaging 1.00
R3900:Rictor UTSW 15 6789473 missense probably benign 0.01
R4376:Rictor UTSW 15 6786967 missense probably benign 0.00
R4611:Rictor UTSW 15 6787144 missense possibly damaging 0.75
R4644:Rictor UTSW 15 6777935 nonsense probably null
R4718:Rictor UTSW 15 6783160 missense possibly damaging 0.81
R4822:Rictor UTSW 15 6791680 missense probably benign 0.01
R4980:Rictor UTSW 15 6781660 missense probably damaging 1.00
R5034:Rictor UTSW 15 6768095 missense probably damaging 0.98
R5179:Rictor UTSW 15 6795940 missense probably damaging 1.00
R5386:Rictor UTSW 15 6789504 missense probably benign 0.37
R5532:Rictor UTSW 15 6789565 missense probably damaging 1.00
R5549:Rictor UTSW 15 6786910 missense probably damaging 1.00
R5715:Rictor UTSW 15 6750716 nonsense probably null
R5733:Rictor UTSW 15 6783104 missense probably benign
R5822:Rictor UTSW 15 6794006 missense probably benign 0.00
R5848:Rictor UTSW 15 6794006 missense probably benign 0.00
R5849:Rictor UTSW 15 6794006 missense probably benign 0.00
R5850:Rictor UTSW 15 6794006 missense probably benign 0.00
R5854:Rictor UTSW 15 6794006 missense probably benign 0.00
R5855:Rictor UTSW 15 6794006 missense probably benign 0.00
R5856:Rictor UTSW 15 6794006 missense probably benign 0.00
R5936:Rictor UTSW 15 6784161 missense probably damaging 0.99
R6155:Rictor UTSW 15 6793977 missense probably benign 0.44
R6394:Rictor UTSW 15 6769309 missense possibly damaging 0.59
R6549:Rictor UTSW 15 6796175 missense probably damaging 1.00
R6611:Rictor UTSW 15 6750659 missense probably damaging 1.00
R6657:Rictor UTSW 15 6759496 missense possibly damaging 0.94
R6705:Rictor UTSW 15 6794012 missense probably benign 0.00
R6819:Rictor UTSW 15 6796036 critical splice donor site probably null
R6985:Rictor UTSW 15 6772154 missense probably benign 0.27
R6989:Rictor UTSW 15 6772154 missense probably benign 0.27
R7016:Rictor UTSW 15 6774880 critical splice donor site probably null
R7030:Rictor UTSW 15 6708453 critical splice donor site probably null
R7066:Rictor UTSW 15 6772154 missense probably benign 0.27
R7067:Rictor UTSW 15 6772154 missense probably benign 0.27
R7216:Rictor UTSW 15 6769301 missense probably damaging 1.00
R7396:Rictor UTSW 15 6786981 missense not run
R7449:Rictor UTSW 15 6772154 missense probably benign 0.27
R7450:Rictor UTSW 15 6772154 missense probably benign 0.27
R7452:Rictor UTSW 15 6772154 missense probably benign 0.27
R7616:Rictor UTSW 15 6772154 missense probably benign 0.27
R7620:Rictor UTSW 15 6772154 missense probably benign 0.27
R7643:Rictor UTSW 15 6769269 nonsense probably null
R7699:Rictor UTSW 15 6772154 missense probably benign 0.27
R7700:Rictor UTSW 15 6772154 missense probably benign 0.27
R7749:Rictor UTSW 15 6772154 missense probably benign 0.27
R7750:Rictor UTSW 15 6772154 missense probably benign 0.27
R7751:Rictor UTSW 15 6772154 missense probably benign 0.27
R7753:Rictor UTSW 15 6772154 missense probably benign 0.27
R7841:Rictor UTSW 15 6772154 missense probably benign 0.27
R7894:Rictor UTSW 15 6772154 missense probably benign 0.27
R7897:Rictor UTSW 15 6772154 missense probably benign 0.27
R7898:Rictor UTSW 15 6772154 missense probably benign 0.27
R7937:Rictor UTSW 15 6772154 missense probably benign 0.27
R7944:Rictor UTSW 15 6772154 missense probably benign 0.27
R8062:Rictor UTSW 15 6772154 missense probably benign 0.27
R8063:Rictor UTSW 15 6772154 missense probably benign 0.27
R8094:Rictor UTSW 15 6772154 missense probably benign 0.27
R8119:Rictor UTSW 15 6772154 missense probably benign 0.27
R8166:Rictor UTSW 15 6769334 critical splice donor site probably null
R8324:Rictor UTSW 15 6745562 missense probably damaging 1.00
R8343:Rictor UTSW 15 6778319 critical splice donor site probably null
R8691:Rictor UTSW 15 6787032 missense probably damaging 1.00
R8859:Rictor UTSW 15 6783586 missense probably damaging 0.98
R8953:Rictor UTSW 15 6794447 missense probably benign 0.39
R8977:Rictor UTSW 15 6783085 missense probably benign
R9008:Rictor UTSW 15 6772129 splice site probably benign
R9369:Rictor UTSW 15 6744367 missense probably benign 0.00
R9563:Rictor UTSW 15 6768081 missense possibly damaging 0.83
R9695:Rictor UTSW 15 6786529 missense probably benign 0.00
X0020:Rictor UTSW 15 6756482 missense probably benign 0.32
X0060:Rictor UTSW 15 6786552 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GATTGGCAACTTTTAGAAGCCA -3'
(R):5'- AGAATTGTAACTTCCCCTTCTTGG -3'

Sequencing Primer
(F):5'- CCATGTAGATCCTGGGATAGAACTC -3'
(R):5'- ACACAACCTATCAACTCCTTGTTTTC -3'
Posted On 2020-06-30