Incidental Mutation 'R8134:Scaf11'
ID632194
Institutional Source Beutler Lab
Gene Symbol Scaf11
Ensembl Gene ENSMUSG00000033228
Gene NameSR-related CTD-associated factor 11
SynonymsSrsf2ip, Sfrs2ip, SIP1, CASP11, 1110061H03Rik, SRRP129, 2610510E10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8134 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location96411699-96460843 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 96420711 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 324 (N324S)
Ref Sequence ENSEMBL: ENSMUSP00000044898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047835] [ENSMUST00000227069] [ENSMUST00000228535]
Predicted Effect probably damaging
Transcript: ENSMUST00000047835
AA Change: N324S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000044898
Gene: ENSMUSG00000033228
AA Change: N324S

DomainStartEndE-ValueType
RING 41 81 1.57e-2 SMART
low complexity region 308 327 N/A INTRINSIC
low complexity region 376 394 N/A INTRINSIC
low complexity region 398 412 N/A INTRINSIC
low complexity region 852 860 N/A INTRINSIC
low complexity region 919 978 N/A INTRINSIC
low complexity region 1089 1108 N/A INTRINSIC
low complexity region 1177 1188 N/A INTRINSIC
low complexity region 1283 1311 N/A INTRINSIC
low complexity region 1346 1359 N/A INTRINSIC
Blast:IG_like 1374 1415 5e-9 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000227069
AA Change: N324S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000228072
Predicted Effect probably benign
Transcript: ENSMUST00000228260
Predicted Effect probably benign
Transcript: ENSMUST00000228535
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.5%
  • 20x: 93.5%
Validation Efficiency 99% (71/72)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abce1 G A 8: 79,699,353 P265L probably benign Het
Adam20 A G 8: 40,796,064 T404A probably benign Het
Anp32a G T 9: 62,377,581 R237L unknown Het
Ascc3 A G 10: 50,767,458 D1835G probably benign Het
Atg9b A G 5: 24,385,222 probably null Het
Bard1 A T 1: 71,067,138 N443K probably damaging Het
Btnl1 A G 17: 34,385,673 D476G possibly damaging Het
C2cd3 A T 7: 100,418,504 I487F Het
Cadm4 A G 7: 24,503,605 E384G possibly damaging Het
Camsap3 A G 8: 3,598,075 K128E probably benign Het
Casz1 C T 4: 148,943,035 P1005S probably damaging Het
Cd38 C A 5: 43,901,448 L135M probably damaging Het
Cdk20 A G 13: 64,437,920 E244G probably benign Het
Cfap54 A T 10: 92,878,516 V2667D unknown Het
Col11a1 A G 3: 114,218,786 K1792E unknown Het
Cpne9 A T 6: 113,295,042 D377V probably benign Het
Csmd1 A T 8: 15,932,550 C2706S probably damaging Het
Ctnnbl1 T C 2: 157,809,471 V222A probably benign Het
Frmpd2 T C 14: 33,505,495 S277P probably benign Het
Gm15922 A G 7: 3,735,839 S590P probably damaging Het
Herc2 C T 7: 56,085,136 T158I probably benign Het
Hoxa4 G T 6: 52,190,557 H215N possibly damaging Het
Hpd G T 5: 123,174,380 Q309K probably benign Het
Il20ra A G 10: 19,750,704 T159A probably damaging Het
Ints10 T A 8: 68,802,986 Y209* probably null Het
Ints2 A G 11: 86,212,660 I1190T probably damaging Het
Jhy A G 9: 40,960,892 V107A probably null Het
Kdm4d C T 9: 14,463,236 R442H probably damaging Het
Kif1bp T C 10: 62,577,977 Y134C probably benign Het
Klb A T 5: 65,383,615 H1017L probably benign Het
Kndc1 T A 7: 139,901,369 probably null Het
Krtap4-1 GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC 11: 99,627,834 probably benign Het
Lrrn3 T C 12: 41,453,048 I423M probably damaging Het
Magi2 T G 5: 20,391,367 F274L probably damaging Het
Magi2 T A 5: 20,391,394 D283E probably benign Het
Map3k19 A C 1: 127,823,755 S620A probably damaging Het
Meis2 C T 2: 115,866,888 M388I probably benign Het
Ms4a3 G C 19: 11,638,249 H54Q probably benign Het
Nfe2l1 A T 11: 96,819,759 M548K possibly damaging Het
Ninl C T 2: 150,950,314 C763Y probably benign Het
Numa1 T C 7: 102,001,627 F1522L probably benign Het
Olfr1344 T C 7: 6,438,923 probably benign Het
Olfr539 T A 7: 140,667,767 I153N possibly damaging Het
Pcdhgc3 G A 18: 37,806,863 V106I probably benign Het
Phf3 A G 1: 30,824,471 V152A unknown Het
Plcg2 A T 8: 117,557,318 D118V probably damaging Het
Pnpla1 A G 17: 28,878,469 D203G probably damaging Het
Ppip5k2 A T 1: 97,745,163 M474K probably benign Het
Ppp1r12b T C 1: 134,886,542 E341G possibly damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rrs1 C T 1: 9,545,420 probably benign Het
Spaca1 T A 4: 34,042,157 probably null Het
Sun3 G T 11: 9,029,346 D118E probably benign Het
Svop C T 5: 114,042,931 V215I probably benign Het
Tbc1d15 A T 10: 115,209,569 C497S probably damaging Het
Tdrd6 A T 17: 43,626,173 I1328N probably damaging Het
Tuba8 T A 6: 121,221,422 D116E probably benign Het
Ube2z A G 11: 96,058,374 I213T possibly damaging Het
Ubqln4 G A 3: 88,555,490 probably null Het
Vps13a A G 19: 16,654,354 I2639T possibly damaging Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zfp94 A T 7: 24,303,741 V92E probably benign Het
Other mutations in Scaf11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Scaf11 APN 15 96418580 missense possibly damaging 0.94
IGL01386:Scaf11 APN 15 96420480 missense probably damaging 1.00
IGL01449:Scaf11 APN 15 96419126 missense probably benign 0.04
IGL01547:Scaf11 APN 15 96418429 missense probably benign 0.14
IGL01697:Scaf11 APN 15 96423623 splice site probably benign
IGL01780:Scaf11 APN 15 96420844 missense possibly damaging 0.94
IGL02311:Scaf11 APN 15 96418756 missense probably benign 0.01
IGL02740:Scaf11 APN 15 96419002 missense probably benign 0.01
IGL02805:Scaf11 APN 15 96420182 missense possibly damaging 0.69
IGL03383:Scaf11 APN 15 96420183 splice site probably null
R0173:Scaf11 UTSW 15 96420194 missense probably benign 0.00
R0379:Scaf11 UTSW 15 96431816 missense probably damaging 1.00
R0508:Scaf11 UTSW 15 96420487 missense probably damaging 1.00
R0648:Scaf11 UTSW 15 96418458 missense possibly damaging 0.72
R0653:Scaf11 UTSW 15 96418641 nonsense probably null
R0727:Scaf11 UTSW 15 96419443 missense probably damaging 1.00
R0829:Scaf11 UTSW 15 96418689 missense probably damaging 1.00
R0839:Scaf11 UTSW 15 96423553 missense probably damaging 1.00
R0843:Scaf11 UTSW 15 96431825 missense probably damaging 1.00
R0882:Scaf11 UTSW 15 96418295 missense possibly damaging 0.75
R1994:Scaf11 UTSW 15 96418840 nonsense probably null
R2092:Scaf11 UTSW 15 96415827 missense probably damaging 0.98
R2125:Scaf11 UTSW 15 96419315 missense possibly damaging 0.69
R2200:Scaf11 UTSW 15 96420523 missense probably damaging 1.00
R3409:Scaf11 UTSW 15 96414864 missense probably damaging 1.00
R3751:Scaf11 UTSW 15 96418536 missense probably damaging 0.99
R4308:Scaf11 UTSW 15 96446515 missense probably benign 0.00
R4424:Scaf11 UTSW 15 96418428 missense possibly damaging 0.78
R4519:Scaf11 UTSW 15 96424838 missense probably damaging 1.00
R4646:Scaf11 UTSW 15 96420100 splice site probably null
R4647:Scaf11 UTSW 15 96420100 splice site probably null
R4724:Scaf11 UTSW 15 96414848 missense probably benign 0.40
R4748:Scaf11 UTSW 15 96420421 nonsense probably null
R4926:Scaf11 UTSW 15 96418242 missense possibly damaging 0.87
R4978:Scaf11 UTSW 15 96415917 missense probably damaging 1.00
R5105:Scaf11 UTSW 15 96420432 missense probably damaging 1.00
R5120:Scaf11 UTSW 15 96419542 missense probably benign 0.26
R5277:Scaf11 UTSW 15 96419226 missense probably damaging 1.00
R5377:Scaf11 UTSW 15 96417120 missense possibly damaging 0.55
R5394:Scaf11 UTSW 15 96419458 missense probably benign 0.28
R5481:Scaf11 UTSW 15 96420617 missense probably damaging 1.00
R5831:Scaf11 UTSW 15 96417081 missense probably benign 0.14
R5941:Scaf11 UTSW 15 96420308 missense probably damaging 0.99
R6123:Scaf11 UTSW 15 96420454 missense probably benign 0.29
R6166:Scaf11 UTSW 15 96424662 missense probably damaging 1.00
R6504:Scaf11 UTSW 15 96419460 splice site probably null
R6863:Scaf11 UTSW 15 96419419 missense probably damaging 1.00
R7135:Scaf11 UTSW 15 96420328 missense possibly damaging 0.82
R7193:Scaf11 UTSW 15 96419161 missense probably damaging 1.00
R7384:Scaf11 UTSW 15 96420387 missense possibly damaging 0.92
R7790:Scaf11 UTSW 15 96419061 missense possibly damaging 0.60
R8056:Scaf11 UTSW 15 96414817 nonsense probably null
R8104:Scaf11 UTSW 15 96418602 missense probably benign 0.34
R8129:Scaf11 UTSW 15 96419469 missense probably damaging 1.00
R8523:Scaf11 UTSW 15 96419107 missense probably damaging 1.00
R8743:Scaf11 UTSW 15 96415788 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TTTTCAGCGGGAGGTACAG -3'
(R):5'- GCACTTAACAGTTTGAGTCACAAG -3'

Sequencing Primer
(F):5'- CGGGAGGTACAGATCTCCTAAGTTTC -3'
(R):5'- TGAGTCACAAGTATACTGTTTTACTG -3'
Posted On2020-06-30