Incidental Mutation 'R8134:Scaf11'
ID 632194
Institutional Source Beutler Lab
Gene Symbol Scaf11
Ensembl Gene ENSMUSG00000033228
Gene Name SR-related CTD-associated factor 11
Synonyms 2610510E10Rik, Srsf2ip, SIP1, Sfrs2ip, SRRP129, CASP11, 1110061H03Rik
MMRRC Submission 067562-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8134 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 96309580-96358695 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 96318592 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 324 (N324S)
Ref Sequence ENSEMBL: ENSMUSP00000044898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047835] [ENSMUST00000227069] [ENSMUST00000228535]
AlphaFold E9PZM7
Predicted Effect probably damaging
Transcript: ENSMUST00000047835
AA Change: N324S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000044898
Gene: ENSMUSG00000033228
AA Change: N324S

DomainStartEndE-ValueType
RING 41 81 1.57e-2 SMART
low complexity region 308 327 N/A INTRINSIC
low complexity region 376 394 N/A INTRINSIC
low complexity region 398 412 N/A INTRINSIC
low complexity region 852 860 N/A INTRINSIC
low complexity region 919 978 N/A INTRINSIC
low complexity region 1089 1108 N/A INTRINSIC
low complexity region 1177 1188 N/A INTRINSIC
low complexity region 1283 1311 N/A INTRINSIC
low complexity region 1346 1359 N/A INTRINSIC
Blast:IG_like 1374 1415 5e-9 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000227069
AA Change: N324S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000228072
Predicted Effect probably benign
Transcript: ENSMUST00000228260
Predicted Effect probably benign
Transcript: ENSMUST00000228535
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.5%
  • 20x: 93.5%
Validation Efficiency 99% (71/72)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abce1 G A 8: 80,425,982 (GRCm39) P265L probably benign Het
Adam20 A G 8: 41,249,101 (GRCm39) T404A probably benign Het
Anp32a G T 9: 62,284,863 (GRCm39) R237L unknown Het
Ascc3 A G 10: 50,643,554 (GRCm39) D1835G probably benign Het
Atg9b A G 5: 24,590,220 (GRCm39) probably null Het
Bard1 A T 1: 71,106,297 (GRCm39) N443K probably damaging Het
Btnl1 A G 17: 34,604,647 (GRCm39) D476G possibly damaging Het
C2cd3 A T 7: 100,067,711 (GRCm39) I487F Het
Cadm4 A G 7: 24,203,030 (GRCm39) E384G possibly damaging Het
Camsap3 A G 8: 3,648,075 (GRCm39) K128E probably benign Het
Casz1 C T 4: 149,027,492 (GRCm39) P1005S probably damaging Het
Cd38 C A 5: 44,058,790 (GRCm39) L135M probably damaging Het
Cdk20 A G 13: 64,585,734 (GRCm39) E244G probably benign Het
Cfap54 A T 10: 92,714,378 (GRCm39) V2667D unknown Het
Col11a1 A G 3: 114,012,435 (GRCm39) K1792E unknown Het
Cpne9 A T 6: 113,272,003 (GRCm39) D377V probably benign Het
Csmd1 A T 8: 15,982,550 (GRCm39) C2706S probably damaging Het
Ctnnbl1 T C 2: 157,651,391 (GRCm39) V222A probably benign Het
Frmpd2 T C 14: 33,227,452 (GRCm39) S277P probably benign Het
Herc2 C T 7: 55,734,884 (GRCm39) T158I probably benign Het
Hoxa4 G T 6: 52,167,537 (GRCm39) H215N possibly damaging Het
Hpd G T 5: 123,312,443 (GRCm39) Q309K probably benign Het
Il20ra A G 10: 19,626,452 (GRCm39) T159A probably damaging Het
Ints10 T A 8: 69,255,638 (GRCm39) Y209* probably null Het
Ints2 A G 11: 86,103,486 (GRCm39) I1190T probably damaging Het
Jhy A G 9: 40,872,188 (GRCm39) V107A probably null Het
Kdm4d C T 9: 14,374,532 (GRCm39) R442H probably damaging Het
Kifbp T C 10: 62,413,756 (GRCm39) Y134C probably benign Het
Klb A T 5: 65,540,958 (GRCm39) H1017L probably benign Het
Kndc1 T A 7: 139,481,285 (GRCm39) probably null Het
Krtap4-1 GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC 11: 99,518,660 (GRCm39) probably benign Het
Lrrn3 T C 12: 41,503,047 (GRCm39) I423M probably damaging Het
Magi2 T G 5: 20,596,365 (GRCm39) F274L probably damaging Het
Magi2 T A 5: 20,596,392 (GRCm39) D283E probably benign Het
Map3k19 A C 1: 127,751,492 (GRCm39) S620A probably damaging Het
Meis2 C T 2: 115,697,369 (GRCm39) M388I probably benign Het
Ms4a3 G C 19: 11,615,613 (GRCm39) H54Q probably benign Het
Nfe2l1 A T 11: 96,710,585 (GRCm39) M548K possibly damaging Het
Ninl C T 2: 150,792,234 (GRCm39) C763Y probably benign Het
Numa1 T C 7: 101,650,834 (GRCm39) F1522L probably benign Het
Or13a25 T A 7: 140,247,680 (GRCm39) I153N possibly damaging Het
Or2bd2 T C 7: 6,441,922 (GRCm39) probably benign Het
Pcdhgc3 G A 18: 37,939,916 (GRCm39) V106I probably benign Het
Phf3 A G 1: 30,863,552 (GRCm39) V152A unknown Het
Pira1 A G 7: 3,738,838 (GRCm39) S590P probably damaging Het
Plcg2 A T 8: 118,284,057 (GRCm39) D118V probably damaging Het
Pnpla1 A G 17: 29,097,443 (GRCm39) D203G probably damaging Het
Ppip5k2 A T 1: 97,672,888 (GRCm39) M474K probably benign Het
Ppp1r12b T C 1: 134,814,280 (GRCm39) E341G possibly damaging Het
Rictor C T 15: 6,801,635 (GRCm39) S441L probably benign Het
Rrs1 C T 1: 9,615,645 (GRCm39) probably benign Het
Spaca1 T A 4: 34,042,157 (GRCm39) probably null Het
Sun3 G T 11: 8,979,346 (GRCm39) D118E probably benign Het
Svop C T 5: 114,180,992 (GRCm39) V215I probably benign Het
Tbc1d15 A T 10: 115,045,474 (GRCm39) C497S probably damaging Het
Tdrd6 A T 17: 43,937,064 (GRCm39) I1328N probably damaging Het
Tuba8 T A 6: 121,198,381 (GRCm39) D116E probably benign Het
Ube2z A G 11: 95,949,200 (GRCm39) I213T possibly damaging Het
Ubqln4 G A 3: 88,462,797 (GRCm39) probably null Het
Vps13a A G 19: 16,631,718 (GRCm39) I2639T possibly damaging Het
Zfp217 G A 2: 169,961,571 (GRCm39) S252F possibly damaging Het
Zfp94 A T 7: 24,003,166 (GRCm39) V92E probably benign Het
Other mutations in Scaf11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Scaf11 APN 15 96,316,461 (GRCm39) missense possibly damaging 0.94
IGL01386:Scaf11 APN 15 96,318,361 (GRCm39) missense probably damaging 1.00
IGL01449:Scaf11 APN 15 96,317,007 (GRCm39) missense probably benign 0.04
IGL01547:Scaf11 APN 15 96,316,310 (GRCm39) missense probably benign 0.14
IGL01697:Scaf11 APN 15 96,321,504 (GRCm39) splice site probably benign
IGL01780:Scaf11 APN 15 96,318,725 (GRCm39) missense possibly damaging 0.94
IGL02311:Scaf11 APN 15 96,316,637 (GRCm39) missense probably benign 0.01
IGL02740:Scaf11 APN 15 96,316,883 (GRCm39) missense probably benign 0.01
IGL02805:Scaf11 APN 15 96,318,063 (GRCm39) missense possibly damaging 0.69
IGL03383:Scaf11 APN 15 96,318,064 (GRCm39) splice site probably null
R0173:Scaf11 UTSW 15 96,318,075 (GRCm39) missense probably benign 0.00
R0379:Scaf11 UTSW 15 96,329,697 (GRCm39) missense probably damaging 1.00
R0508:Scaf11 UTSW 15 96,318,368 (GRCm39) missense probably damaging 1.00
R0648:Scaf11 UTSW 15 96,316,339 (GRCm39) missense possibly damaging 0.72
R0653:Scaf11 UTSW 15 96,316,522 (GRCm39) nonsense probably null
R0727:Scaf11 UTSW 15 96,317,324 (GRCm39) missense probably damaging 1.00
R0829:Scaf11 UTSW 15 96,316,570 (GRCm39) missense probably damaging 1.00
R0839:Scaf11 UTSW 15 96,321,434 (GRCm39) missense probably damaging 1.00
R0843:Scaf11 UTSW 15 96,329,706 (GRCm39) missense probably damaging 1.00
R0882:Scaf11 UTSW 15 96,316,176 (GRCm39) missense possibly damaging 0.75
R1994:Scaf11 UTSW 15 96,316,721 (GRCm39) nonsense probably null
R2092:Scaf11 UTSW 15 96,313,708 (GRCm39) missense probably damaging 0.98
R2125:Scaf11 UTSW 15 96,317,196 (GRCm39) missense possibly damaging 0.69
R2200:Scaf11 UTSW 15 96,318,404 (GRCm39) missense probably damaging 1.00
R3409:Scaf11 UTSW 15 96,312,745 (GRCm39) missense probably damaging 1.00
R3751:Scaf11 UTSW 15 96,316,417 (GRCm39) missense probably damaging 0.99
R4308:Scaf11 UTSW 15 96,344,396 (GRCm39) missense probably benign 0.00
R4424:Scaf11 UTSW 15 96,316,309 (GRCm39) missense possibly damaging 0.78
R4519:Scaf11 UTSW 15 96,322,719 (GRCm39) missense probably damaging 1.00
R4646:Scaf11 UTSW 15 96,317,981 (GRCm39) splice site probably null
R4647:Scaf11 UTSW 15 96,317,981 (GRCm39) splice site probably null
R4724:Scaf11 UTSW 15 96,312,729 (GRCm39) missense probably benign 0.40
R4748:Scaf11 UTSW 15 96,318,302 (GRCm39) nonsense probably null
R4926:Scaf11 UTSW 15 96,316,123 (GRCm39) missense possibly damaging 0.87
R4978:Scaf11 UTSW 15 96,313,798 (GRCm39) missense probably damaging 1.00
R5105:Scaf11 UTSW 15 96,318,313 (GRCm39) missense probably damaging 1.00
R5120:Scaf11 UTSW 15 96,317,423 (GRCm39) missense probably benign 0.26
R5277:Scaf11 UTSW 15 96,317,107 (GRCm39) missense probably damaging 1.00
R5377:Scaf11 UTSW 15 96,315,001 (GRCm39) missense possibly damaging 0.55
R5394:Scaf11 UTSW 15 96,317,339 (GRCm39) missense probably benign 0.28
R5481:Scaf11 UTSW 15 96,318,498 (GRCm39) missense probably damaging 1.00
R5831:Scaf11 UTSW 15 96,314,962 (GRCm39) missense probably benign 0.14
R5941:Scaf11 UTSW 15 96,318,189 (GRCm39) missense probably damaging 0.99
R6123:Scaf11 UTSW 15 96,318,335 (GRCm39) missense probably benign 0.29
R6166:Scaf11 UTSW 15 96,322,543 (GRCm39) missense probably damaging 1.00
R6504:Scaf11 UTSW 15 96,317,341 (GRCm39) splice site probably null
R6863:Scaf11 UTSW 15 96,317,300 (GRCm39) missense probably damaging 1.00
R7135:Scaf11 UTSW 15 96,318,209 (GRCm39) missense possibly damaging 0.82
R7193:Scaf11 UTSW 15 96,317,042 (GRCm39) missense probably damaging 1.00
R7384:Scaf11 UTSW 15 96,318,268 (GRCm39) missense possibly damaging 0.92
R7790:Scaf11 UTSW 15 96,316,942 (GRCm39) missense possibly damaging 0.60
R8056:Scaf11 UTSW 15 96,312,698 (GRCm39) nonsense probably null
R8104:Scaf11 UTSW 15 96,316,483 (GRCm39) missense probably benign 0.34
R8129:Scaf11 UTSW 15 96,317,350 (GRCm39) missense probably damaging 1.00
R8523:Scaf11 UTSW 15 96,316,988 (GRCm39) missense probably damaging 1.00
R8743:Scaf11 UTSW 15 96,313,669 (GRCm39) missense probably benign 0.16
R8955:Scaf11 UTSW 15 96,318,371 (GRCm39) missense probably damaging 0.98
R8987:Scaf11 UTSW 15 96,316,557 (GRCm39) nonsense probably null
R9118:Scaf11 UTSW 15 96,319,886 (GRCm39) missense probably benign
R9127:Scaf11 UTSW 15 96,312,764 (GRCm39) missense probably benign 0.01
R9534:Scaf11 UTSW 15 96,318,209 (GRCm39) missense possibly damaging 0.84
R9628:Scaf11 UTSW 15 96,317,398 (GRCm39) missense probably benign 0.15
R9630:Scaf11 UTSW 15 96,316,049 (GRCm39) missense probably damaging 1.00
R9688:Scaf11 UTSW 15 96,313,808 (GRCm39) missense probably damaging 1.00
R9689:Scaf11 UTSW 15 96,316,195 (GRCm39) missense probably damaging 1.00
R9746:Scaf11 UTSW 15 96,318,298 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTCAGCGGGAGGTACAG -3'
(R):5'- GCACTTAACAGTTTGAGTCACAAG -3'

Sequencing Primer
(F):5'- CGGGAGGTACAGATCTCCTAAGTTTC -3'
(R):5'- TGAGTCACAAGTATACTGTTTTACTG -3'
Posted On 2020-06-30