Incidental Mutation 'R8134:Pnpla1'
ID632195
Institutional Source Beutler Lab
Gene Symbol Pnpla1
Ensembl Gene ENSMUSG00000043286
Gene Namepatatin-like phospholipase domain containing 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R8134 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location28858411-28890308 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28878469 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 203 (D203G)
Ref Sequence ENSEMBL: ENSMUSP00000050123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056866] [ENSMUST00000114737]
Predicted Effect probably damaging
Transcript: ENSMUST00000056866
AA Change: D203G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000050123
Gene: ENSMUSG00000043286
AA Change: D203G

DomainStartEndE-ValueType
Pfam:Patatin 16 183 1.4e-14 PFAM
low complexity region 443 454 N/A INTRINSIC
low complexity region 462 479 N/A INTRINSIC
low complexity region 549 564 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114737
AA Change: D203G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110385
Gene: ENSMUSG00000043286
AA Change: D203G

DomainStartEndE-ValueType
Pfam:Patatin 16 183 9.3e-15 PFAM
low complexity region 443 454 N/A INTRINSIC
low complexity region 462 479 N/A INTRINSIC
low complexity region 549 564 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.5%
  • 20x: 93.5%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the patatin-like phospholipase (PNPLA) family, which is characterized by the presence of a highly conserved patatin domain. PNPLA family members have diverse lipolytic and acyltransferase activities, and are key elements in lipid metabolism. While other members of this family have been well characterized, the function of this gene remained an enigma. However, recent studies show that this gene is expressed in the skin epidermal keratinocytes, and has a role in glycerophospholipid metabolism in the cutaneous barrier. Consistent with these observations, mutations in this gene are associated with ichthyosis in human (autosomal recessive congenital ichthyoses, ARCI) and dog. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality; shiny, red, dry, wrinkled and non-elastic skin; reduced size and weight at birth; fail to suckle; and exhibit skin defects associated with a lack of omega-O-acylceramides. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abce1 G A 8: 79,699,353 P265L probably benign Het
Adam20 A G 8: 40,796,064 T404A probably benign Het
Anp32a G T 9: 62,377,581 R237L unknown Het
Ascc3 A G 10: 50,767,458 D1835G probably benign Het
Atg9b A G 5: 24,385,222 probably null Het
Bard1 A T 1: 71,067,138 N443K probably damaging Het
Btnl1 A G 17: 34,385,673 D476G possibly damaging Het
C2cd3 A T 7: 100,418,504 I487F Het
Cadm4 A G 7: 24,503,605 E384G possibly damaging Het
Camsap3 A G 8: 3,598,075 K128E probably benign Het
Casz1 C T 4: 148,943,035 P1005S probably damaging Het
Cd38 C A 5: 43,901,448 L135M probably damaging Het
Cdk20 A G 13: 64,437,920 E244G probably benign Het
Cfap54 A T 10: 92,878,516 V2667D unknown Het
Col11a1 A G 3: 114,218,786 K1792E unknown Het
Cpne9 A T 6: 113,295,042 D377V probably benign Het
Csmd1 A T 8: 15,932,550 C2706S probably damaging Het
Ctnnbl1 T C 2: 157,809,471 V222A probably benign Het
Frmpd2 T C 14: 33,505,495 S277P probably benign Het
Gm15922 A G 7: 3,735,839 S590P probably damaging Het
Herc2 C T 7: 56,085,136 T158I probably benign Het
Hoxa4 G T 6: 52,190,557 H215N possibly damaging Het
Hpd G T 5: 123,174,380 Q309K probably benign Het
Il20ra A G 10: 19,750,704 T159A probably damaging Het
Ints10 T A 8: 68,802,986 Y209* probably null Het
Ints2 A G 11: 86,212,660 I1190T probably damaging Het
Jhy A G 9: 40,960,892 V107A probably null Het
Kdm4d C T 9: 14,463,236 R442H probably damaging Het
Kif1bp T C 10: 62,577,977 Y134C probably benign Het
Klb A T 5: 65,383,615 H1017L probably benign Het
Kndc1 T A 7: 139,901,369 probably null Het
Krtap4-1 GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC 11: 99,627,834 probably benign Het
Lrrn3 T C 12: 41,453,048 I423M probably damaging Het
Magi2 T G 5: 20,391,367 F274L probably damaging Het
Magi2 T A 5: 20,391,394 D283E probably benign Het
Map3k19 A C 1: 127,823,755 S620A probably damaging Het
Meis2 C T 2: 115,866,888 M388I probably benign Het
Ms4a3 G C 19: 11,638,249 H54Q probably benign Het
Nfe2l1 A T 11: 96,819,759 M548K possibly damaging Het
Ninl C T 2: 150,950,314 C763Y probably benign Het
Numa1 T C 7: 102,001,627 F1522L probably benign Het
Olfr1344 T C 7: 6,438,923 probably benign Het
Olfr539 T A 7: 140,667,767 I153N possibly damaging Het
Pcdhgc3 G A 18: 37,806,863 V106I probably benign Het
Phf3 A G 1: 30,824,471 V152A unknown Het
Plcg2 A T 8: 117,557,318 D118V probably damaging Het
Ppip5k2 A T 1: 97,745,163 M474K probably benign Het
Ppp1r12b T C 1: 134,886,542 E341G possibly damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rrs1 C T 1: 9,545,420 probably benign Het
Scaf11 T C 15: 96,420,711 N324S probably damaging Het
Spaca1 T A 4: 34,042,157 probably null Het
Sun3 G T 11: 9,029,346 D118E probably benign Het
Svop C T 5: 114,042,931 V215I probably benign Het
Tbc1d15 A T 10: 115,209,569 C497S probably damaging Het
Tdrd6 A T 17: 43,626,173 I1328N probably damaging Het
Tuba8 T A 6: 121,221,422 D116E probably benign Het
Ube2z A G 11: 96,058,374 I213T possibly damaging Het
Ubqln4 G A 3: 88,555,490 probably null Het
Vps13a A G 19: 16,654,354 I2639T possibly damaging Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zfp94 A T 7: 24,303,741 V92E probably benign Het
Other mutations in Pnpla1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Pnpla1 APN 17 28877442 missense probably damaging 1.00
IGL01713:Pnpla1 APN 17 28881605 missense possibly damaging 0.46
IGL02972:Pnpla1 APN 17 28886947 missense probably null 0.65
IGL03350:Pnpla1 APN 17 28876992 missense probably damaging 1.00
R0335:Pnpla1 UTSW 17 28886878 missense possibly damaging 0.48
R1727:Pnpla1 UTSW 17 28878534 missense probably benign 0.30
R3620:Pnpla1 UTSW 17 28877388 missense probably damaging 1.00
R3621:Pnpla1 UTSW 17 28877388 missense probably damaging 1.00
R4831:Pnpla1 UTSW 17 28878544 missense probably benign 0.28
R5011:Pnpla1 UTSW 17 28885584 missense possibly damaging 0.57
R5042:Pnpla1 UTSW 17 28881047 missense probably benign
R5068:Pnpla1 UTSW 17 28879423 splice site probably null
R5690:Pnpla1 UTSW 17 28878372 missense probably damaging 1.00
R5886:Pnpla1 UTSW 17 28876863 missense possibly damaging 0.63
R6269:Pnpla1 UTSW 17 28881368 missense probably benign 0.00
R6270:Pnpla1 UTSW 17 28881368 missense probably benign 0.00
R6271:Pnpla1 UTSW 17 28881368 missense probably benign 0.00
R6272:Pnpla1 UTSW 17 28881368 missense probably benign 0.00
R6369:Pnpla1 UTSW 17 28878481 missense probably damaging 1.00
R6611:Pnpla1 UTSW 17 28881047 missense probably benign
R6962:Pnpla1 UTSW 17 28878481 missense probably damaging 1.00
R7359:Pnpla1 UTSW 17 28881185 missense probably benign 0.25
R7400:Pnpla1 UTSW 17 28858976 missense probably damaging 1.00
R7444:Pnpla1 UTSW 17 28878481 missense possibly damaging 0.95
R7507:Pnpla1 UTSW 17 28876817 missense probably damaging 1.00
R7513:Pnpla1 UTSW 17 28858807 start gained probably benign
R8271:Pnpla1 UTSW 17 28881605 missense probably benign 0.26
R8353:Pnpla1 UTSW 17 28858899 missense probably benign 0.20
R8453:Pnpla1 UTSW 17 28858899 missense probably benign 0.20
R8880:Pnpla1 UTSW 17 28879464 missense probably damaging 1.00
X0019:Pnpla1 UTSW 17 28881067 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TAGAGATGCAGCAAGTGGCC -3'
(R):5'- AAAACCATGGGCCCTCTGAG -3'

Sequencing Primer
(F):5'- AACCACCATTTATCTTGGGGAC -3'
(R):5'- CTCTGAGGGGAGAGGCAC -3'
Posted On2020-06-30