Incidental Mutation 'R8134:Ms4a3'
ID 632199
Institutional Source Beutler Lab
Gene Symbol Ms4a3
Ensembl Gene ENSMUSG00000024681
Gene Name membrane-spanning 4-domains, subfamily A, member 3
Synonyms haematopoietic cell-specific transmembrane-4, HTm4
MMRRC Submission 067562-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8134 (G1)
Quality Score 187.009
Status Validated
Chromosome 19
Chromosomal Location 11606863-11618215 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to C at 11615613 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 54 (H54Q)
Ref Sequence ENSEMBL: ENSMUSP00000108608 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112984] [ENSMUST00000186023]
AlphaFold Q920C4
Predicted Effect probably benign
Transcript: ENSMUST00000112984
AA Change: H54Q

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000108608
Gene: ENSMUSG00000024681
AA Change: H54Q

DomainStartEndE-ValueType
Pfam:CD20 27 172 2.3e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186023
AA Change: H54Q

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000140508
Gene: ENSMUSG00000024681
AA Change: H54Q

DomainStartEndE-ValueType
Pfam:CD20 27 172 9.5e-36 PFAM
Meta Mutation Damage Score 0.0935 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.5%
  • 20x: 93.5%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: Summary:This gene encodes a member of the membrane-spanning-four (MS4) protein group, that contain a four-transmembrane protein structure. This gene is expressed in developing hematopoietic cells and has also been observed in some regions of the adult brain. Expression of the human ortholog of this gene has also been observed in some human cancer cell lines. This protein may play a role in cell cycle regulation, and interactions have been demonstrated between Ms4a3 and KAP phosphatase. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abce1 G A 8: 80,425,982 (GRCm39) P265L probably benign Het
Adam20 A G 8: 41,249,101 (GRCm39) T404A probably benign Het
Anp32a G T 9: 62,284,863 (GRCm39) R237L unknown Het
Ascc3 A G 10: 50,643,554 (GRCm39) D1835G probably benign Het
Atg9b A G 5: 24,590,220 (GRCm39) probably null Het
Bard1 A T 1: 71,106,297 (GRCm39) N443K probably damaging Het
Btnl1 A G 17: 34,604,647 (GRCm39) D476G possibly damaging Het
C2cd3 A T 7: 100,067,711 (GRCm39) I487F Het
Cadm4 A G 7: 24,203,030 (GRCm39) E384G possibly damaging Het
Camsap3 A G 8: 3,648,075 (GRCm39) K128E probably benign Het
Casz1 C T 4: 149,027,492 (GRCm39) P1005S probably damaging Het
Cd38 C A 5: 44,058,790 (GRCm39) L135M probably damaging Het
Cdk20 A G 13: 64,585,734 (GRCm39) E244G probably benign Het
Cfap54 A T 10: 92,714,378 (GRCm39) V2667D unknown Het
Col11a1 A G 3: 114,012,435 (GRCm39) K1792E unknown Het
Cpne9 A T 6: 113,272,003 (GRCm39) D377V probably benign Het
Csmd1 A T 8: 15,982,550 (GRCm39) C2706S probably damaging Het
Ctnnbl1 T C 2: 157,651,391 (GRCm39) V222A probably benign Het
Frmpd2 T C 14: 33,227,452 (GRCm39) S277P probably benign Het
Herc2 C T 7: 55,734,884 (GRCm39) T158I probably benign Het
Hoxa4 G T 6: 52,167,537 (GRCm39) H215N possibly damaging Het
Hpd G T 5: 123,312,443 (GRCm39) Q309K probably benign Het
Il20ra A G 10: 19,626,452 (GRCm39) T159A probably damaging Het
Ints10 T A 8: 69,255,638 (GRCm39) Y209* probably null Het
Ints2 A G 11: 86,103,486 (GRCm39) I1190T probably damaging Het
Jhy A G 9: 40,872,188 (GRCm39) V107A probably null Het
Kdm4d C T 9: 14,374,532 (GRCm39) R442H probably damaging Het
Kifbp T C 10: 62,413,756 (GRCm39) Y134C probably benign Het
Klb A T 5: 65,540,958 (GRCm39) H1017L probably benign Het
Kndc1 T A 7: 139,481,285 (GRCm39) probably null Het
Krtap4-1 GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC 11: 99,518,660 (GRCm39) probably benign Het
Lrrn3 T C 12: 41,503,047 (GRCm39) I423M probably damaging Het
Magi2 T G 5: 20,596,365 (GRCm39) F274L probably damaging Het
Magi2 T A 5: 20,596,392 (GRCm39) D283E probably benign Het
Map3k19 A C 1: 127,751,492 (GRCm39) S620A probably damaging Het
Meis2 C T 2: 115,697,369 (GRCm39) M388I probably benign Het
Nfe2l1 A T 11: 96,710,585 (GRCm39) M548K possibly damaging Het
Ninl C T 2: 150,792,234 (GRCm39) C763Y probably benign Het
Numa1 T C 7: 101,650,834 (GRCm39) F1522L probably benign Het
Or13a25 T A 7: 140,247,680 (GRCm39) I153N possibly damaging Het
Or2bd2 T C 7: 6,441,922 (GRCm39) probably benign Het
Pcdhgc3 G A 18: 37,939,916 (GRCm39) V106I probably benign Het
Phf3 A G 1: 30,863,552 (GRCm39) V152A unknown Het
Pira1 A G 7: 3,738,838 (GRCm39) S590P probably damaging Het
Plcg2 A T 8: 118,284,057 (GRCm39) D118V probably damaging Het
Pnpla1 A G 17: 29,097,443 (GRCm39) D203G probably damaging Het
Ppip5k2 A T 1: 97,672,888 (GRCm39) M474K probably benign Het
Ppp1r12b T C 1: 134,814,280 (GRCm39) E341G possibly damaging Het
Rictor C T 15: 6,801,635 (GRCm39) S441L probably benign Het
Rrs1 C T 1: 9,615,645 (GRCm39) probably benign Het
Scaf11 T C 15: 96,318,592 (GRCm39) N324S probably damaging Het
Spaca1 T A 4: 34,042,157 (GRCm39) probably null Het
Sun3 G T 11: 8,979,346 (GRCm39) D118E probably benign Het
Svop C T 5: 114,180,992 (GRCm39) V215I probably benign Het
Tbc1d15 A T 10: 115,045,474 (GRCm39) C497S probably damaging Het
Tdrd6 A T 17: 43,937,064 (GRCm39) I1328N probably damaging Het
Tuba8 T A 6: 121,198,381 (GRCm39) D116E probably benign Het
Ube2z A G 11: 95,949,200 (GRCm39) I213T possibly damaging Het
Ubqln4 G A 3: 88,462,797 (GRCm39) probably null Het
Vps13a A G 19: 16,631,718 (GRCm39) I2639T possibly damaging Het
Zfp217 G A 2: 169,961,571 (GRCm39) S252F possibly damaging Het
Zfp94 A T 7: 24,003,166 (GRCm39) V92E probably benign Het
Other mutations in Ms4a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01155:Ms4a3 APN 19 11,607,019 (GRCm39) utr 3 prime probably benign
IGL01370:Ms4a3 APN 19 11,610,245 (GRCm39) missense probably benign 0.01
IGL01901:Ms4a3 APN 19 11,616,630 (GRCm39) missense possibly damaging 0.86
IGL01950:Ms4a3 APN 19 11,610,199 (GRCm39) missense probably damaging 1.00
R0609:Ms4a3 UTSW 19 11,608,725 (GRCm39) missense possibly damaging 0.79
R1546:Ms4a3 UTSW 19 11,610,271 (GRCm39) missense probably benign 0.10
R1938:Ms4a3 UTSW 19 11,613,204 (GRCm39) missense possibly damaging 0.94
R2367:Ms4a3 UTSW 19 11,607,108 (GRCm39) missense probably benign 0.22
R3890:Ms4a3 UTSW 19 11,610,271 (GRCm39) missense probably benign 0.10
R4727:Ms4a3 UTSW 19 11,608,742 (GRCm39) missense probably damaging 0.97
R6103:Ms4a3 UTSW 19 11,616,582 (GRCm39) missense possibly damaging 0.86
R6908:Ms4a3 UTSW 19 11,615,659 (GRCm39) missense probably damaging 1.00
R9437:Ms4a3 UTSW 19 11,607,065 (GRCm39) missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- CAGAAAGAAAGAGACTTTTGCCTAC -3'
(R):5'- GGCTTTGTCGTATTTCTCAGAAC -3'

Sequencing Primer
(F):5'- AAGAGACTTTTGCCTACTTTTGTTG -3'
(R):5'- GCCATCCAGATCCTGAAT -3'
Posted On 2020-06-30