Incidental Mutation 'R8135:Fasl'
ID632204
Institutional Source Beutler Lab
Gene Symbol Fasl
Ensembl Gene ENSMUSG00000000817
Gene NameFas ligand (TNF superfamily, member 6)
SynonymsAPT1LG1, CD178, CD95L, Fas-L, Tnfsf6
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.499) question?
Stock #R8135 (G1)
Quality Score200.009
Status Not validated
Chromosome1
Chromosomal Location161780689-161788495 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 161787128 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 122 (V122A)
Ref Sequence ENSEMBL: ENSMUSP00000000834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000834] [ENSMUST00000193648]
Predicted Effect probably benign
Transcript: ENSMUST00000000834
AA Change: V122A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000000834
Gene: ENSMUSG00000000817
AA Change: V122A

DomainStartEndE-ValueType
low complexity region 45 70 N/A INTRINSIC
transmembrane domain 78 100 N/A INTRINSIC
TNF 143 279 2.29e-54 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193648
SMART Domains Protein: ENSMUSP00000141422
Gene: ENSMUSG00000000817

DomainStartEndE-ValueType
Pfam:TNF 1 69 2.3e-15 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.7%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the tumor necrosis factor superfamily. The primary function of the encoded transmembrane protein is the induction of apoptosis triggered by binding to FAS. The FAS/FASLG signaling pathway is essential for immune system regulation, including activation-induced cell death (AICD) of T cells and cytotoxic T lymphocyte induced cell death. It has also been implicated in the progression of several cancers. Defects in this gene may be related to some cases of systemic lupus erythematosus (SLE). Alternatively spliced transcript variants have been described. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a spontaneous allele, knock-out allele, or allele producting only the soluble isoform exhibit premature death due to the development of systemic lupus erythematosus, autoimmune glomerulonephritis, hepatomegaly, lymphadenopathy, and hypergammaglobulinaemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl3 A G 1: 78,696,995 I420V probably benign Het
Adam7 A T 14: 68,516,573 M359K probably damaging Het
Adra1d C T 2: 131,561,772 A133T probably damaging Het
B3galnt2 T A 13: 13,970,869 probably null Het
Camk1g A G 1: 193,354,027 V175A possibly damaging Het
Cfi A G 3: 129,855,000 N178D probably benign Het
Csf2rb T A 15: 78,348,119 I542K possibly damaging Het
Ctsz T C 2: 174,429,153 T183A probably benign Het
Dhx8 A G 11: 101,738,264 D213G unknown Het
Dph7 T C 2: 24,969,544 I271T probably benign Het
Edem1 G T 6: 108,829,061 E108* probably null Het
Enpp4 T C 17: 44,101,335 T328A probably benign Het
Fut2 T C 7: 45,651,142 T69A probably damaging Het
Gaa T C 11: 119,278,384 probably null Het
Galnt5 T A 2: 58,014,868 V481D probably damaging Het
Gsdma2 A G 11: 98,652,046 I211V probably benign Het
H2-M10.4 T C 17: 36,461,770 T107A probably benign Het
Iqcg T A 16: 33,029,024 K297N probably benign Het
Map2 A G 1: 66,413,669 T573A probably damaging Het
Nhsl1 A G 10: 18,531,432 D1438G probably damaging Het
Nipal2 A T 15: 34,678,573 Y41N possibly damaging Het
Obscn A T 11: 59,031,877 S5878T possibly damaging Het
Pde6a T C 18: 61,285,925 F791L probably damaging Het
Phip A T 9: 82,930,374 N308K probably benign Het
Pigc A G 1: 161,970,565 K39E possibly damaging Het
Robo2 T G 16: 73,933,160 I1050L probably benign Het
Rps2 A G 17: 24,720,435 K54E probably benign Het
Set T A 2: 30,069,427 D137E probably benign Het
Sipa1l1 A G 12: 82,341,301 I100M probably benign Het
Spdye4b T C 5: 143,195,022 V81A probably damaging Het
Tbc1d2 T C 4: 46,609,071 D722G probably benign Het
Tecpr1 T A 5: 144,198,602 D1011V probably damaging Het
Unc80 A T 1: 66,509,287 I573F possibly damaging Het
Vmn1r74 T A 7: 11,847,603 C277S probably benign Het
Vwa1 T A 4: 155,772,894 D149V probably damaging Het
Zfp397 T A 18: 23,956,507 V23E probably damaging Het
Zmynd8 T C 2: 165,812,426 D722G probably damaging Het
Other mutations in Fasl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Fasl APN 1 161781838 missense probably damaging 0.99
IGL01510:Fasl APN 1 161781953 missense possibly damaging 0.50
riogrande UTSW 1 161788164 missense probably benign
riogrande2 UTSW 1 161787138 missense probably benign 0.00
ANU22:Fasl UTSW 1 161781838 missense probably damaging 0.99
R0012:Fasl UTSW 1 161788164 missense probably benign
R0454:Fasl UTSW 1 161787954 missense probably benign 0.16
R2167:Fasl UTSW 1 161787138 missense probably benign 0.00
R3794:Fasl UTSW 1 161781737 missense probably benign 0.16
R3911:Fasl UTSW 1 161788191 missense probably benign 0.10
R4082:Fasl UTSW 1 161781851 missense probably damaging 1.00
R4596:Fasl UTSW 1 161788269 missense probably benign 0.31
R4622:Fasl UTSW 1 161787134 missense probably benign 0.00
R6785:Fasl UTSW 1 161781835 missense probably benign 0.10
R6969:Fasl UTSW 1 161781675 missense probably damaging 0.98
R7248:Fasl UTSW 1 161788191 missense possibly damaging 0.90
R7336:Fasl UTSW 1 161787988 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAACGAAGAGTCAAAAGCTCC -3'
(R):5'- CCTCTCTGAGTTGTCAAGGGTG -3'

Sequencing Primer
(F):5'- GAGTCAAAAGCTCCTCAGGGTTTC -3'
(R):5'- CGCTGCTTCATGTTTAGTGATTCAAG -3'
Posted On2020-06-30