Incidental Mutation 'R8135:Pigc'
ID632205
Institutional Source Beutler Lab
Gene Symbol Pigc
Ensembl Gene ENSMUSG00000026698
Gene Namephosphatidylinositol glycan anchor biosynthesis, class C
Synonyms3110030E07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8135 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location161969186-161973435 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 161970565 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 39 (K39E)
Ref Sequence ENSEMBL: ENSMUSP00000125321 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028021] [ENSMUST00000111594] [ENSMUST00000159648] [ENSMUST00000160881] [ENSMUST00000162676] [ENSMUST00000193784]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028021
AA Change: K39E

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000028021
Gene: ENSMUSG00000026698
AA Change: K39E

DomainStartEndE-ValueType
Pfam:GPI2 14 284 6.2e-90 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111594
AA Change: K39E

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107221
Gene: ENSMUSG00000026698
AA Change: K39E

DomainStartEndE-ValueType
Pfam:GPI2 14 284 1.7e-94 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141397
Predicted Effect probably benign
Transcript: ENSMUST00000159648
Predicted Effect possibly damaging
Transcript: ENSMUST00000160881
AA Change: K39E

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000125321
Gene: ENSMUSG00000026698
AA Change: K39E

DomainStartEndE-ValueType
Pfam:GPI2 14 140 2.8e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161826
Predicted Effect probably benign
Transcript: ENSMUST00000162676
SMART Domains Protein: ENSMUSP00000124751
Gene: ENSMUSG00000086277

DomainStartEndE-ValueType
Pfam:DUF4548 17 181 1.9e-89 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000193784
AA Change: K39E

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000141646
Gene: ENSMUSG00000026698
AA Change: K39E

DomainStartEndE-ValueType
Pfam:GPI2 14 284 1.7e-94 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.7%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an endoplasmic reticulum associated protein that is involved in glycosylphosphatidylinositol (GPI) lipid anchor biosynthesis. The GPI lipid anchor is a glycolipid found on many blood cells and serves to anchor proteins to the cell surface. The encoded protein is one subunit of the GPI N-acetylglucosaminyl (GlcNAc) transferase that transfers GlcNAc to phosphatidylinositol (PI) on the cytoplasmic side of the endoplasmic reticulum. Two alternatively spliced transcripts that encode the same protein have been found for this gene. A pseudogene on chromosome 11 has also been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl3 A G 1: 78,696,995 I420V probably benign Het
Adam7 A T 14: 68,516,573 M359K probably damaging Het
Adra1d C T 2: 131,561,772 A133T probably damaging Het
B3galnt2 T A 13: 13,970,869 probably null Het
Camk1g A G 1: 193,354,027 V175A possibly damaging Het
Cfi A G 3: 129,855,000 N178D probably benign Het
Csf2rb T A 15: 78,348,119 I542K possibly damaging Het
Ctsz T C 2: 174,429,153 T183A probably benign Het
Dhx8 A G 11: 101,738,264 D213G unknown Het
Dph7 T C 2: 24,969,544 I271T probably benign Het
Edem1 G T 6: 108,829,061 E108* probably null Het
Enpp4 T C 17: 44,101,335 T328A probably benign Het
Fasl A G 1: 161,787,128 V122A probably benign Het
Fut2 T C 7: 45,651,142 T69A probably damaging Het
Gaa T C 11: 119,278,384 probably null Het
Galnt5 T A 2: 58,014,868 V481D probably damaging Het
Gsdma2 A G 11: 98,652,046 I211V probably benign Het
H2-M10.4 T C 17: 36,461,770 T107A probably benign Het
Iqcg T A 16: 33,029,024 K297N probably benign Het
Map2 A G 1: 66,413,669 T573A probably damaging Het
Nhsl1 A G 10: 18,531,432 D1438G probably damaging Het
Nipal2 A T 15: 34,678,573 Y41N possibly damaging Het
Obscn A T 11: 59,031,877 S5878T possibly damaging Het
Pde6a T C 18: 61,285,925 F791L probably damaging Het
Phip A T 9: 82,930,374 N308K probably benign Het
Robo2 T G 16: 73,933,160 I1050L probably benign Het
Rps2 A G 17: 24,720,435 K54E probably benign Het
Set T A 2: 30,069,427 D137E probably benign Het
Sipa1l1 A G 12: 82,341,301 I100M probably benign Het
Spdye4b T C 5: 143,195,022 V81A probably damaging Het
Tbc1d2 T C 4: 46,609,071 D722G probably benign Het
Tecpr1 T A 5: 144,198,602 D1011V probably damaging Het
Unc80 A T 1: 66,509,287 I573F possibly damaging Het
Vmn1r74 T A 7: 11,847,603 C277S probably benign Het
Vwa1 T A 4: 155,772,894 D149V probably damaging Het
Zfp397 T A 18: 23,956,507 V23E probably damaging Het
Zmynd8 T C 2: 165,812,426 D722G probably damaging Het
Other mutations in Pigc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01725:Pigc APN 1 161971345 utr 3 prime probably benign
IGL02009:Pigc APN 1 161970565 missense possibly damaging 0.95
IGL02586:Pigc APN 1 161970934 missense probably benign 0.02
IGL03095:Pigc APN 1 161970776 missense possibly damaging 0.79
IGL03109:Pigc APN 1 161970776 missense possibly damaging 0.79
apocryphon UTSW 1 161971094 missense probably benign 0.21
pistis UTSW 1 161970947 missense probably damaging 0.99
R6228_Pigc_444 UTSW 1 161970467 missense probably benign 0.03
R0321:Pigc UTSW 1 161971099 nonsense probably null
R1450:Pigc UTSW 1 161971253 missense probably benign 0.01
R1708:Pigc UTSW 1 161970724 missense probably benign 0.00
R1857:Pigc UTSW 1 161970877 missense possibly damaging 0.90
R1875:Pigc UTSW 1 161970947 missense probably damaging 0.99
R2371:Pigc UTSW 1 161971010 missense possibly damaging 0.72
R2940:Pigc UTSW 1 161970670 missense possibly damaging 0.96
R3706:Pigc UTSW 1 161971094 missense probably benign 0.21
R3707:Pigc UTSW 1 161971094 missense probably benign 0.21
R3708:Pigc UTSW 1 161971094 missense probably benign 0.21
R3725:Pigc UTSW 1 161971291 missense possibly damaging 0.95
R5193:Pigc UTSW 1 161970896 missense possibly damaging 0.91
R5682:Pigc UTSW 1 161970947 missense probably damaging 0.99
R6228:Pigc UTSW 1 161970467 missense probably benign 0.03
R7143:Pigc UTSW 1 161970592 missense probably damaging 1.00
R7509:Pigc UTSW 1 161970976 missense probably benign 0.06
R7829:Pigc UTSW 1 161970464 missense probably benign
R8030:Pigc UTSW 1 161970547 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGTATCAGCATGGCATTTC -3'
(R):5'- ACCAAGGAAGATGCCAGTC -3'

Sequencing Primer
(F):5'- GGCATTTCCAGAGAGTTCTTAATC -3'
(R):5'- AGGAAGATGCCAGTCCGGTC -3'
Posted On2020-06-30