Mutagenetix > Incidental Mutations

Incidental Mutation 'R8135:Galnt5'

632209

Institutional Source

Beutler Lab

Gene Symbol

Galnt5

Ensembl Gene

ENSMUSG00000026828

Gene Name

polypeptide N-acetylgalactosaminyltransferase 5

Synonyms

ppGaNTase-T5

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8135 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

57997884-58045860 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 58014868 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 481 (V481D)

Ref Sequence

ENSEMBL: ENSMUSP00000108235 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112616] [ENSMUST00000166729]

AlphaFold

Q8C102

Predicted Effect

probably damaging
Transcript: ENSMUST00000112616
AA Change: V481D

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000108235
Gene: ENSMUSG00000026828
AA Change: V481D

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
low complexity region	319	330	N/A	INTRINSIC
Pfam:Glycos_transf_2	489	672	1.3e-33	PFAM
Pfam:Glyco_transf_7C	653	718	1.9e-8	PFAM
RICIN	801	925	1.36e-19	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000166729
AA Change: V481D

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000131362
Gene: ENSMUSG00000026828
AA Change: V481D

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
low complexity region	319	330	N/A	INTRINSIC
Pfam:Glycos_transf_2	489	672	2.1e-30	PFAM
Pfam:Glyco_transf_7C	652	718	7e-8	PFAM
RICIN	801	925	1.36e-19	SMART

Coding Region Coverage

1x: 99.8%
3x: 99.6%
10x: 98.7%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane-bound polypeptide N-acetylgalactosaminyltransferase that is found in the Golgi. The encoded protein catalyzes the first step in the mucin-type O-glycosylation of Golgi proteins, transfering an N-acetyl-D-galactosamine residue to a serine or threonine residue on the protein receptor. [provided by RefSeq, Aug 2016]
PHENOTYPE: An unpublished knockout mutation is reported to have no overt phenotypic consequences. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsl3	A	G	1: 78,696,995	I420V	probably benign	Het
Adam7	A	T	14: 68,516,573	M359K	probably damaging	Het
Adra1d	C	T	2: 131,561,772	A133T	probably damaging	Het
B3galnt2	T	A	13: 13,970,869		probably null	Het
Camk1g	A	G	1: 193,354,027	V175A	possibly damaging	Het
Cfi	A	G	3: 129,855,000	N178D	probably benign	Het
Csf2rb	T	A	15: 78,348,119	I542K	possibly damaging	Het
Ctsz	T	C	2: 174,429,153	T183A	probably benign	Het
Dhx8	A	G	11: 101,738,264	D213G	unknown	Het
Dph7	T	C	2: 24,969,544	I271T	probably benign	Het
Edem1	G	T	6: 108,829,061	E108*	probably null	Het
Enpp4	T	C	17: 44,101,335	T328A	probably benign	Het
Fasl	A	G	1: 161,787,128	V122A	probably benign	Het
Fut2	T	C	7: 45,651,142	T69A	probably damaging	Het
Gaa	T	C	11: 119,278,384		probably null	Het
Gsdma2	A	G	11: 98,652,046	I211V	probably benign	Het
H2-M10.4	T	C	17: 36,461,770	T107A	probably benign	Het
Iqcg	T	A	16: 33,029,024	K297N	probably benign	Het
Map2	A	G	1: 66,413,669	T573A	probably damaging	Het
Nhsl1	A	G	10: 18,531,432	D1438G	probably damaging	Het
Nipal2	A	T	15: 34,678,573	Y41N	possibly damaging	Het
Obscn	A	T	11: 59,031,877	S5878T	possibly damaging	Het
Pde6a	T	C	18: 61,285,925	F791L	probably damaging	Het
Phip	A	T	9: 82,930,374	N308K	probably benign	Het
Pigc	A	G	1: 161,970,565	K39E	possibly damaging	Het
Robo2	T	G	16: 73,933,160	I1050L	probably benign	Het
Rps2	A	G	17: 24,720,435	K54E	probably benign	Het
Set	T	A	2: 30,069,427	D137E	probably benign	Het
Sipa1l1	A	G	12: 82,341,301	I100M	probably benign	Het
Spdye4b	T	C	5: 143,195,022	V81A	probably damaging	Het
Tbc1d2	T	C	4: 46,609,071	D722G	probably benign	Het
Tecpr1	T	A	5: 144,198,602	D1011V	probably damaging	Het
Unc80	A	T	1: 66,509,287	I573F	possibly damaging	Het
Vmn1r74	T	A	7: 11,847,603	C277S	probably benign	Het
Vwa1	T	A	4: 155,772,894	D149V	probably damaging	Het
Zfp397	T	A	18: 23,956,507	V23E	probably damaging	Het
Zmynd8	T	C	2: 165,812,426	D722G	probably damaging	Het

Other mutations in Galnt5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00230:Galnt5	APN	2	57998973	missense	probably benign
IGL00515:Galnt5	APN	2	57999068	missense	probably benign	0.02
IGL00950:Galnt5	APN	2	57999132	missense	probably benign	0.00
IGL00973:Galnt5	APN	2	57998939	missense	probably benign	0.02
IGL01152:Galnt5	APN	2	58025393	missense	probably benign	0.17
IGL01305:Galnt5	APN	2	58025342	nonsense	probably null
IGL01661:Galnt5	APN	2	57999482	missense	probably benign	0.03
IGL01719:Galnt5	APN	2	57998543	missense	probably damaging	1.00
IGL02165:Galnt5	APN	2	57998865	missense	probably benign
IGL02795:Galnt5	APN	2	58027871	missense	probably damaging	1.00
IGL02943:Galnt5	APN	2	57999768	missense	probably damaging	1.00
IGL03218:Galnt5	APN	2	57999389	missense	possibly damaging	0.59
ANU22:Galnt5	UTSW	2	58025342	nonsense	probably null
R0082:Galnt5	UTSW	2	57999035	missense	possibly damaging	0.92
R0113:Galnt5	UTSW	2	57998877	missense	probably benign
R0445:Galnt5	UTSW	2	57998950	missense	probably benign
R0517:Galnt5	UTSW	2	58035373	splice site	probably benign
R0609:Galnt5	UTSW	2	58024625	missense	possibly damaging	0.90
R0639:Galnt5	UTSW	2	57999395	missense	probably benign	0.07
R0646:Galnt5	UTSW	2	57999085	missense	probably benign	0.00
R0677:Galnt5	UTSW	2	57998980	nonsense	probably null
R1808:Galnt5	UTSW	2	58026125	missense	probably benign	0.24
R1927:Galnt5	UTSW	2	57998603	missense	probably benign	0.00
R1980:Galnt5	UTSW	2	58024723	critical splice donor site	probably null
R2517:Galnt5	UTSW	2	57999413	missense	probably benign	0.00
R4044:Galnt5	UTSW	2	57998460	missense	probably damaging	1.00
R4154:Galnt5	UTSW	2	57998493	missense	probably damaging	1.00
R4411:Galnt5	UTSW	2	57999195	missense	probably benign	0.01
R4703:Galnt5	UTSW	2	57998907	missense	possibly damaging	0.96
R4767:Galnt5	UTSW	2	58028144	missense	possibly damaging	0.91
R5118:Galnt5	UTSW	2	58015003	missense	probably damaging	1.00
R5497:Galnt5	UTSW	2	58025328	missense	probably damaging	0.99
R5506:Galnt5	UTSW	2	57999625	missense	probably benign
R5548:Galnt5	UTSW	2	58014910	missense	probably damaging	0.99
R5758:Galnt5	UTSW	2	57998430	missense	probably benign	0.19
R5937:Galnt5	UTSW	2	58038937	missense	probably benign	0.00
R6237:Galnt5	UTSW	2	58035249	missense	probably damaging	0.96
R6805:Galnt5	UTSW	2	58035299	missense	possibly damaging	0.82
R6959:Galnt5	UTSW	2	57999219	missense	probably benign	0.39
R7070:Galnt5	UTSW	2	57998609	missense	probably benign	0.00
R7179:Galnt5	UTSW	2	57998609	missense	probably benign	0.06
R7347:Galnt5	UTSW	2	58017193	missense	probably benign	0.33
R7419:Galnt5	UTSW	2	58014925	missense	probably damaging	1.00
R7426:Galnt5	UTSW	2	58017139	missense	probably damaging	0.99
R7492:Galnt5	UTSW	2	58026036	splice site	probably null
R7539:Galnt5	UTSW	2	58035230	missense	probably damaging	0.99
R7623:Galnt5	UTSW	2	58017210	missense	probably damaging	0.99
R8155:Galnt5	UTSW	2	57999415	missense	probably benign	0.01
R8544:Galnt5	UTSW	2	58017148	missense	probably damaging	1.00
R9267:Galnt5	UTSW	2	58035208	missense	possibly damaging	0.58

Predicted Primers

PCR Primer
(F):5'- CAAAGGAGGCATCATGTCTGC -3'
(R):5'- GCAGAAAGAATCCCAAAAGGTTTTC -3'

Sequencing Primer
(F):5'- GCATCATGTCTGCCATTGTTAG -3'
(R):5'- CTTACCTTTGGTGCTGAAGTCATC -3'

Posted On

2020-06-30