Incidental Mutation 'R8135:Adra1d'
ID632210
Institutional Source Beutler Lab
Gene Symbol Adra1d
Ensembl Gene ENSMUSG00000027335
Gene Nameadrenergic receptor, alpha 1d
SynonymsAdra1, Gpcr8, alpha1D-AR, Adra1a, Adra-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R8135 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location131545850-131562283 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 131561772 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 133 (A133T)
Ref Sequence ENSEMBL: ENSMUSP00000099473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103184]
Predicted Effect probably damaging
Transcript: ENSMUST00000103184
AA Change: A133T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099473
Gene: ENSMUSG00000027335
AA Change: A133T

DomainStartEndE-ValueType
low complexity region 13 57 N/A INTRINSIC
low complexity region 65 83 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 98 228 7.4e-7 PFAM
Pfam:7TM_GPCR_Srsx 101 411 8.9e-14 PFAM
Pfam:7tm_1 107 396 4.5e-78 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.7%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alpha-1-adrenergic receptors (alpha-1-ARs) are members of the G protein-coupled receptor superfamily. They activate mitogenic responses and regulate growth and proliferation of many cells. There are 3 alpha-1-AR subtypes: alpha-1A, -1B and -1D, all of which signal through the Gq/11 family of G-proteins and different subtypes show different patterns of activation. This gene encodes alpha-1D-adrenergic receptor. Similar to alpha-1B-adrenergic receptor gene, this gene comprises 2 exons and a single intron that interrupts the coding region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display hypotension or reduced rearing behavior in a novel environment, decreased wheel-running activity during the night, and reduced hyperlocomotion after amphetamine administration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl3 A G 1: 78,696,995 I420V probably benign Het
Adam7 A T 14: 68,516,573 M359K probably damaging Het
B3galnt2 T A 13: 13,970,869 probably null Het
Camk1g A G 1: 193,354,027 V175A possibly damaging Het
Cfi A G 3: 129,855,000 N178D probably benign Het
Csf2rb T A 15: 78,348,119 I542K possibly damaging Het
Ctsz T C 2: 174,429,153 T183A probably benign Het
Dhx8 A G 11: 101,738,264 D213G unknown Het
Dph7 T C 2: 24,969,544 I271T probably benign Het
Edem1 G T 6: 108,829,061 E108* probably null Het
Enpp4 T C 17: 44,101,335 T328A probably benign Het
Fasl A G 1: 161,787,128 V122A probably benign Het
Fut2 T C 7: 45,651,142 T69A probably damaging Het
Gaa T C 11: 119,278,384 probably null Het
Galnt5 T A 2: 58,014,868 V481D probably damaging Het
Gsdma2 A G 11: 98,652,046 I211V probably benign Het
H2-M10.4 T C 17: 36,461,770 T107A probably benign Het
Iqcg T A 16: 33,029,024 K297N probably benign Het
Map2 A G 1: 66,413,669 T573A probably damaging Het
Nhsl1 A G 10: 18,531,432 D1438G probably damaging Het
Nipal2 A T 15: 34,678,573 Y41N possibly damaging Het
Obscn A T 11: 59,031,877 S5878T possibly damaging Het
Pde6a T C 18: 61,285,925 F791L probably damaging Het
Phip A T 9: 82,930,374 N308K probably benign Het
Pigc A G 1: 161,970,565 K39E possibly damaging Het
Robo2 T G 16: 73,933,160 I1050L probably benign Het
Rps2 A G 17: 24,720,435 K54E probably benign Het
Set T A 2: 30,069,427 D137E probably benign Het
Sipa1l1 A G 12: 82,341,301 I100M probably benign Het
Spdye4b T C 5: 143,195,022 V81A probably damaging Het
Tbc1d2 T C 4: 46,609,071 D722G probably benign Het
Tecpr1 T A 5: 144,198,602 D1011V probably damaging Het
Unc80 A T 1: 66,509,287 I573F possibly damaging Het
Vmn1r74 T A 7: 11,847,603 C277S probably benign Het
Vwa1 T A 4: 155,772,894 D149V probably damaging Het
Zfp397 T A 18: 23,956,507 V23E probably damaging Het
Zmynd8 T C 2: 165,812,426 D722G probably damaging Het
Other mutations in Adra1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Adra1d APN 2 131561677 missense possibly damaging 0.83
IGL02198:Adra1d APN 2 131546492 missense probably damaging 0.99
IGL02901:Adra1d APN 2 131561604 missense probably damaging 1.00
IGL03155:Adra1d APN 2 131546081 missense probably benign 0.00
BB006:Adra1d UTSW 2 131561680 nonsense probably null
BB016:Adra1d UTSW 2 131561680 nonsense probably null
R0238:Adra1d UTSW 2 131546214 missense probably benign 0.01
R0239:Adra1d UTSW 2 131546214 missense probably benign 0.01
R0239:Adra1d UTSW 2 131546214 missense probably benign 0.01
R1568:Adra1d UTSW 2 131546172 missense possibly damaging 0.88
R1806:Adra1d UTSW 2 131546149 missense probably benign 0.31
R2192:Adra1d UTSW 2 131561369 missense probably damaging 1.00
R2510:Adra1d UTSW 2 131562135 nonsense probably null
R3913:Adra1d UTSW 2 131562155 missense probably damaging 0.98
R4660:Adra1d UTSW 2 131561142 missense probably damaging 1.00
R5303:Adra1d UTSW 2 131546249 missense possibly damaging 0.87
R5355:Adra1d UTSW 2 131561087 missense probably damaging 1.00
R5428:Adra1d UTSW 2 131561403 missense probably damaging 1.00
R6277:Adra1d UTSW 2 131561163 missense probably damaging 1.00
R6392:Adra1d UTSW 2 131561609 missense probably damaging 1.00
R7200:Adra1d UTSW 2 131561250 missense probably benign 0.00
R7779:Adra1d UTSW 2 131561885 missense probably damaging 0.99
R7929:Adra1d UTSW 2 131561680 nonsense probably null
R8070:Adra1d UTSW 2 131561582 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGATACTTGAGCGAGTGGC -3'
(R):5'- TGAGCGTCACTTTCGAAGG -3'

Sequencing Primer
(F):5'- TGGCGCACACCCACGTAC -3'
(R):5'- TCACTTTCGAAGGACCCCG -3'
Posted On2020-06-30