Incidental Mutation 'R8135:Ctsz'
ID632212
Institutional Source Beutler Lab
Gene Symbol Ctsz
Ensembl Gene ENSMUSG00000016256
Gene Namecathepsin Z
Synonymscathepsin X, CTSX, D2Wsu143e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R8135 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location174427493-174439039 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 174429153 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 183 (T183A)
Ref Sequence ENSEMBL: ENSMUSP00000016400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016397] [ENSMUST00000016400] [ENSMUST00000109075]
Predicted Effect probably benign
Transcript: ENSMUST00000016397
SMART Domains Protein: ENSMUSP00000016397
Gene: ENSMUSG00000016253

DomainStartEndE-ValueType
Pfam:TH1 11 604 6.5e-276 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000016400
AA Change: T183A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000016400
Gene: ENSMUSG00000016256
AA Change: T183A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pept_C1 64 301 5.46e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109075
SMART Domains Protein: ENSMUSP00000104703
Gene: ENSMUSG00000016253

DomainStartEndE-ValueType
Pfam:TH1 10 590 5.6e-303 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.7%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the peptidase C1 (papain) family of cysteine proteases. The encoded preproprotein is proteolytically processed to generate a mature enzyme with carboxypeptidase activity. An enzymatically inactive form of the protein, that is associated with the propeptide, may be involved in cancer cell invasion and proliferation. Homozygous knockout mice for this gene exhibit impaired cancer cell invasion in a breast cancer model. [provided by RefSeq, Aug 2015]
PHENOTYPE: No abnormal pheotype detected in homozygous mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl3 A G 1: 78,696,995 I420V probably benign Het
Adam7 A T 14: 68,516,573 M359K probably damaging Het
Adra1d C T 2: 131,561,772 A133T probably damaging Het
B3galnt2 T A 13: 13,970,869 probably null Het
Camk1g A G 1: 193,354,027 V175A possibly damaging Het
Cfi A G 3: 129,855,000 N178D probably benign Het
Csf2rb T A 15: 78,348,119 I542K possibly damaging Het
Dhx8 A G 11: 101,738,264 D213G unknown Het
Dph7 T C 2: 24,969,544 I271T probably benign Het
Edem1 G T 6: 108,829,061 E108* probably null Het
Enpp4 T C 17: 44,101,335 T328A probably benign Het
Fasl A G 1: 161,787,128 V122A probably benign Het
Fut2 T C 7: 45,651,142 T69A probably damaging Het
Gaa T C 11: 119,278,384 probably null Het
Galnt5 T A 2: 58,014,868 V481D probably damaging Het
Gsdma2 A G 11: 98,652,046 I211V probably benign Het
H2-M10.4 T C 17: 36,461,770 T107A probably benign Het
Iqcg T A 16: 33,029,024 K297N probably benign Het
Map2 A G 1: 66,413,669 T573A probably damaging Het
Nhsl1 A G 10: 18,531,432 D1438G probably damaging Het
Nipal2 A T 15: 34,678,573 Y41N possibly damaging Het
Obscn A T 11: 59,031,877 S5878T possibly damaging Het
Pde6a T C 18: 61,285,925 F791L probably damaging Het
Phip A T 9: 82,930,374 N308K probably benign Het
Pigc A G 1: 161,970,565 K39E possibly damaging Het
Robo2 T G 16: 73,933,160 I1050L probably benign Het
Rps2 A G 17: 24,720,435 K54E probably benign Het
Set T A 2: 30,069,427 D137E probably benign Het
Sipa1l1 A G 12: 82,341,301 I100M probably benign Het
Spdye4b T C 5: 143,195,022 V81A probably damaging Het
Tbc1d2 T C 4: 46,609,071 D722G probably benign Het
Tecpr1 T A 5: 144,198,602 D1011V probably damaging Het
Unc80 A T 1: 66,509,287 I573F possibly damaging Het
Vmn1r74 T A 7: 11,847,603 C277S probably benign Het
Vwa1 T A 4: 155,772,894 D149V probably damaging Het
Zfp397 T A 18: 23,956,507 V23E probably damaging Het
Zmynd8 T C 2: 165,812,426 D722G probably damaging Het
Other mutations in Ctsz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00957:Ctsz APN 2 174427978 missense probably damaging 0.99
IGL02574:Ctsz APN 2 174429098 missense probably benign 0.16
IGL03342:Ctsz APN 2 174429140 missense possibly damaging 0.92
IGL03348:Ctsz APN 2 174428697 missense probably damaging 0.98
R1872:Ctsz UTSW 2 174427976 missense probably benign
R4373:Ctsz UTSW 2 174428585 missense possibly damaging 0.94
R4890:Ctsz UTSW 2 174428600 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGGTACTCAAGCTAGGGG -3'
(R):5'- AGCATGTAATTAGGGAGCACC -3'

Sequencing Primer
(F):5'- TACTCAAGCTAGGGGGTCAC -3'
(R):5'- ACCTGAGCTGGATGGCTTC -3'
Posted On2020-06-30