Mutagenetix > Incidental Mutations

Incidental Mutation 'R8135:Vwa1'

632215

Institutional Source

Beutler Lab

Gene Symbol

Vwa1

Ensembl Gene

ENSMUSG00000042116

Gene Name

von Willebrand factor A domain containing 1

Synonyms

4932416A11Rik, WARP

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8135 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

155768149-155774698 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 155772894 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 149 (D149V)

Ref Sequence

ENSEMBL: ENSMUSP00000040405 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042196]

Predicted Effect

probably damaging
Transcript: ENSMUST00000042196
AA Change: D149V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000040405
Gene: ENSMUSG00000042116
AA Change: D149V

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
VWA	32	210	3.05e-36	SMART
FN3	212	292	1.95e0	SMART
FN3	305	385	1.4e-5	SMART

Coding Region Coverage

1x: 99.8%
3x: 99.6%
10x: 98.7%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] VWA1 belongs to the von Willebrand factor (VWF; MIM 613160) A (VWFA) domain superfamily of extracellular matrix proteins and appears to play a role in cartilage structure and function (Fitzgerald et al., 2002 [PubMed 12062410]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a reporter allele exhibit abnormal motor coordination/balance, increased thermal nociceptive threshold, and altered peripheral nerve structure and function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsl3	A	G	1: 78,696,995	I420V	probably benign	Het
Adam7	A	T	14: 68,516,573	M359K	probably damaging	Het
Adra1d	C	T	2: 131,561,772	A133T	probably damaging	Het
B3galnt2	T	A	13: 13,970,869		probably null	Het
Camk1g	A	G	1: 193,354,027	V175A	possibly damaging	Het
Cfi	A	G	3: 129,855,000	N178D	probably benign	Het
Csf2rb	T	A	15: 78,348,119	I542K	possibly damaging	Het
Ctsz	T	C	2: 174,429,153	T183A	probably benign	Het
Dhx8	A	G	11: 101,738,264	D213G	unknown	Het
Dph7	T	C	2: 24,969,544	I271T	probably benign	Het
Edem1	G	T	6: 108,829,061	E108*	probably null	Het
Enpp4	T	C	17: 44,101,335	T328A	probably benign	Het
Fasl	A	G	1: 161,787,128	V122A	probably benign	Het
Fut2	T	C	7: 45,651,142	T69A	probably damaging	Het
Gaa	T	C	11: 119,278,384		probably null	Het
Galnt5	T	A	2: 58,014,868	V481D	probably damaging	Het
Gsdma2	A	G	11: 98,652,046	I211V	probably benign	Het
H2-M10.4	T	C	17: 36,461,770	T107A	probably benign	Het
Iqcg	T	A	16: 33,029,024	K297N	probably benign	Het
Map2	A	G	1: 66,413,669	T573A	probably damaging	Het
Nhsl1	A	G	10: 18,531,432	D1438G	probably damaging	Het
Nipal2	A	T	15: 34,678,573	Y41N	possibly damaging	Het
Obscn	A	T	11: 59,031,877	S5878T	possibly damaging	Het
Pde6a	T	C	18: 61,285,925	F791L	probably damaging	Het
Phip	A	T	9: 82,930,374	N308K	probably benign	Het
Pigc	A	G	1: 161,970,565	K39E	possibly damaging	Het
Robo2	T	G	16: 73,933,160	I1050L	probably benign	Het
Rps2	A	G	17: 24,720,435	K54E	probably benign	Het
Set	T	A	2: 30,069,427	D137E	probably benign	Het
Sipa1l1	A	G	12: 82,341,301	I100M	probably benign	Het
Spdye4b	T	C	5: 143,195,022	V81A	probably damaging	Het
Tbc1d2	T	C	4: 46,609,071	D722G	probably benign	Het
Tecpr1	T	A	5: 144,198,602	D1011V	probably damaging	Het
Unc80	A	T	1: 66,509,287	I573F	possibly damaging	Het
Vmn1r74	T	A	7: 11,847,603	C277S	probably benign	Het
Zfp397	T	A	18: 23,956,507	V23E	probably damaging	Het
Zmynd8	T	C	2: 165,812,426	D722G	probably damaging	Het

Other mutations in Vwa1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01364:Vwa1	APN	4	155770743	critical splice donor site	probably null
IGL01611:Vwa1	APN	4	155770798	missense	possibly damaging	0.64
R1174:Vwa1	UTSW	4	155773266	missense	probably damaging	0.96
R1433:Vwa1	UTSW	4	155772901	missense	probably damaging	0.99
R1953:Vwa1	UTSW	4	155773114	missense	probably damaging	1.00
R2006:Vwa1	UTSW	4	155770850	missense	probably benign
R2105:Vwa1	UTSW	4	155772793	missense	probably damaging	1.00
R2346:Vwa1	UTSW	4	155773069	missense	probably benign	0.00
R3891:Vwa1	UTSW	4	155773194	missense	probably damaging	1.00
R4919:Vwa1	UTSW	4	155770600	missense	probably benign	0.10
R5285:Vwa1	UTSW	4	155770895	missense	probably benign	0.38
R5320:Vwa1	UTSW	4	155770912	missense	probably benign	0.00
R5554:Vwa1	UTSW	4	155773238	missense	probably damaging	1.00
R5666:Vwa1	UTSW	4	155774465	missense	probably damaging	1.00
R5670:Vwa1	UTSW	4	155774465	missense	probably damaging	1.00
R6433:Vwa1	UTSW	4	155772769	missense	probably benign	0.07
R8400:Vwa1	UTSW	4	155772768	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- GTCAGCTAGGGATTCACAGG -3'
(R):5'- ACAGTTCAGGCCAGGCTATAC -3'

Sequencing Primer
(F):5'- TAGGGATTCACAGGACCTGC -3'
(R):5'- TTCAGGCCAGGCTATACAGGATG -3'

Posted On

2020-06-30