Incidental Mutation 'R8135:Vwa1'
ID632215
Institutional Source Beutler Lab
Gene Symbol Vwa1
Ensembl Gene ENSMUSG00000042116
Gene Namevon Willebrand factor A domain containing 1
Synonyms4932416A11Rik, WARP
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8135 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location155768149-155774698 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 155772894 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 149 (D149V)
Ref Sequence ENSEMBL: ENSMUSP00000040405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042196]
Predicted Effect probably damaging
Transcript: ENSMUST00000042196
AA Change: D149V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040405
Gene: ENSMUSG00000042116
AA Change: D149V

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
VWA 32 210 3.05e-36 SMART
FN3 212 292 1.95e0 SMART
FN3 305 385 1.4e-5 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.7%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] VWA1 belongs to the von Willebrand factor (VWF; MIM 613160) A (VWFA) domain superfamily of extracellular matrix proteins and appears to play a role in cartilage structure and function (Fitzgerald et al., 2002 [PubMed 12062410]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a reporter allele exhibit abnormal motor coordination/balance, increased thermal nociceptive threshold, and altered peripheral nerve structure and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl3 A G 1: 78,696,995 I420V probably benign Het
Adam7 A T 14: 68,516,573 M359K probably damaging Het
Adra1d C T 2: 131,561,772 A133T probably damaging Het
B3galnt2 T A 13: 13,970,869 probably null Het
Camk1g A G 1: 193,354,027 V175A possibly damaging Het
Cfi A G 3: 129,855,000 N178D probably benign Het
Csf2rb T A 15: 78,348,119 I542K possibly damaging Het
Ctsz T C 2: 174,429,153 T183A probably benign Het
Dhx8 A G 11: 101,738,264 D213G unknown Het
Dph7 T C 2: 24,969,544 I271T probably benign Het
Edem1 G T 6: 108,829,061 E108* probably null Het
Enpp4 T C 17: 44,101,335 T328A probably benign Het
Fasl A G 1: 161,787,128 V122A probably benign Het
Fut2 T C 7: 45,651,142 T69A probably damaging Het
Gaa T C 11: 119,278,384 probably null Het
Galnt5 T A 2: 58,014,868 V481D probably damaging Het
Gsdma2 A G 11: 98,652,046 I211V probably benign Het
H2-M10.4 T C 17: 36,461,770 T107A probably benign Het
Iqcg T A 16: 33,029,024 K297N probably benign Het
Map2 A G 1: 66,413,669 T573A probably damaging Het
Nhsl1 A G 10: 18,531,432 D1438G probably damaging Het
Nipal2 A T 15: 34,678,573 Y41N possibly damaging Het
Obscn A T 11: 59,031,877 S5878T possibly damaging Het
Pde6a T C 18: 61,285,925 F791L probably damaging Het
Phip A T 9: 82,930,374 N308K probably benign Het
Pigc A G 1: 161,970,565 K39E possibly damaging Het
Robo2 T G 16: 73,933,160 I1050L probably benign Het
Rps2 A G 17: 24,720,435 K54E probably benign Het
Set T A 2: 30,069,427 D137E probably benign Het
Sipa1l1 A G 12: 82,341,301 I100M probably benign Het
Spdye4b T C 5: 143,195,022 V81A probably damaging Het
Tbc1d2 T C 4: 46,609,071 D722G probably benign Het
Tecpr1 T A 5: 144,198,602 D1011V probably damaging Het
Unc80 A T 1: 66,509,287 I573F possibly damaging Het
Vmn1r74 T A 7: 11,847,603 C277S probably benign Het
Zfp397 T A 18: 23,956,507 V23E probably damaging Het
Zmynd8 T C 2: 165,812,426 D722G probably damaging Het
Other mutations in Vwa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Vwa1 APN 4 155770743 critical splice donor site probably null
IGL01611:Vwa1 APN 4 155770798 missense possibly damaging 0.64
R1174:Vwa1 UTSW 4 155773266 missense probably damaging 0.96
R1433:Vwa1 UTSW 4 155772901 missense probably damaging 0.99
R1953:Vwa1 UTSW 4 155773114 missense probably damaging 1.00
R2006:Vwa1 UTSW 4 155770850 missense probably benign
R2105:Vwa1 UTSW 4 155772793 missense probably damaging 1.00
R2346:Vwa1 UTSW 4 155773069 missense probably benign 0.00
R3891:Vwa1 UTSW 4 155773194 missense probably damaging 1.00
R4919:Vwa1 UTSW 4 155770600 missense probably benign 0.10
R5285:Vwa1 UTSW 4 155770895 missense probably benign 0.38
R5320:Vwa1 UTSW 4 155770912 missense probably benign 0.00
R5554:Vwa1 UTSW 4 155773238 missense probably damaging 1.00
R5666:Vwa1 UTSW 4 155774465 missense probably damaging 1.00
R5670:Vwa1 UTSW 4 155774465 missense probably damaging 1.00
R6433:Vwa1 UTSW 4 155772769 missense probably benign 0.07
R8400:Vwa1 UTSW 4 155772768 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GTCAGCTAGGGATTCACAGG -3'
(R):5'- ACAGTTCAGGCCAGGCTATAC -3'

Sequencing Primer
(F):5'- TAGGGATTCACAGGACCTGC -3'
(R):5'- TTCAGGCCAGGCTATACAGGATG -3'
Posted On2020-06-30