Incidental Mutation 'R8135:Edem1'
ID632218
Institutional Source Beutler Lab
Gene Symbol Edem1
Ensembl Gene ENSMUSG00000030104
Gene NameER degradation enhancer, mannosidase alpha-like 1
SynonymsA130059K23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.540) question?
Stock #R8135 (G1)
Quality Score99.0078
Status Not validated
Chromosome6
Chromosomal Location108828641-108859356 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 108829061 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 108 (E108*)
Ref Sequence ENSEMBL: ENSMUSP00000086565 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032196] [ENSMUST00000089162] [ENSMUST00000204804]
Predicted Effect probably benign
Transcript: ENSMUST00000032196
SMART Domains Protein: ENSMUSP00000032196
Gene: ENSMUSG00000030105

DomainStartEndE-ValueType
ARF 1 185 4.46e-35 SMART
Predicted Effect probably null
Transcript: ENSMUST00000089162
AA Change: E108*
SMART Domains Protein: ENSMUSP00000086565
Gene: ENSMUSG00000030104
AA Change: E108*

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
low complexity region 49 61 N/A INTRINSIC
low complexity region 70 92 N/A INTRINSIC
Pfam:Glyco_hydro_47 132 581 1.1e-123 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000204804
AA Change: E108*
SMART Domains Protein: ENSMUSP00000144901
Gene: ENSMUSG00000030104
AA Change: E108*

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
low complexity region 49 61 N/A INTRINSIC
low complexity region 70 92 N/A INTRINSIC
Pfam:Glyco_hydro_47 132 529 9.9e-97 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.7%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl3 A G 1: 78,696,995 I420V probably benign Het
Adam7 A T 14: 68,516,573 M359K probably damaging Het
Adra1d C T 2: 131,561,772 A133T probably damaging Het
B3galnt2 T A 13: 13,970,869 probably null Het
Camk1g A G 1: 193,354,027 V175A possibly damaging Het
Cfi A G 3: 129,855,000 N178D probably benign Het
Csf2rb T A 15: 78,348,119 I542K possibly damaging Het
Ctsz T C 2: 174,429,153 T183A probably benign Het
Dhx8 A G 11: 101,738,264 D213G unknown Het
Dph7 T C 2: 24,969,544 I271T probably benign Het
Enpp4 T C 17: 44,101,335 T328A probably benign Het
Fasl A G 1: 161,787,128 V122A probably benign Het
Fut2 T C 7: 45,651,142 T69A probably damaging Het
Gaa T C 11: 119,278,384 probably null Het
Galnt5 T A 2: 58,014,868 V481D probably damaging Het
Gsdma2 A G 11: 98,652,046 I211V probably benign Het
H2-M10.4 T C 17: 36,461,770 T107A probably benign Het
Iqcg T A 16: 33,029,024 K297N probably benign Het
Map2 A G 1: 66,413,669 T573A probably damaging Het
Nhsl1 A G 10: 18,531,432 D1438G probably damaging Het
Nipal2 A T 15: 34,678,573 Y41N possibly damaging Het
Obscn A T 11: 59,031,877 S5878T possibly damaging Het
Pde6a T C 18: 61,285,925 F791L probably damaging Het
Phip A T 9: 82,930,374 N308K probably benign Het
Pigc A G 1: 161,970,565 K39E possibly damaging Het
Robo2 T G 16: 73,933,160 I1050L probably benign Het
Rps2 A G 17: 24,720,435 K54E probably benign Het
Set T A 2: 30,069,427 D137E probably benign Het
Sipa1l1 A G 12: 82,341,301 I100M probably benign Het
Spdye4b T C 5: 143,195,022 V81A probably damaging Het
Tbc1d2 T C 4: 46,609,071 D722G probably benign Het
Tecpr1 T A 5: 144,198,602 D1011V probably damaging Het
Unc80 A T 1: 66,509,287 I573F possibly damaging Het
Vmn1r74 T A 7: 11,847,603 C277S probably benign Het
Vwa1 T A 4: 155,772,894 D149V probably damaging Het
Zfp397 T A 18: 23,956,507 V23E probably damaging Het
Zmynd8 T C 2: 165,812,426 D722G probably damaging Het
Other mutations in Edem1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:Edem1 APN 6 108855559 utr 3 prime probably benign
IGL00648:Edem1 APN 6 108851207 splice site probably null
IGL00694:Edem1 APN 6 108841601 missense possibly damaging 0.95
IGL02231:Edem1 APN 6 108828888 missense probably benign 0.06
IGL02967:Edem1 APN 6 108836777 missense probably damaging 1.00
IGL03018:Edem1 APN 6 108829142 missense probably damaging 0.98
PIT4468001:Edem1 UTSW 6 108844867 missense probably damaging 0.98
R0050:Edem1 UTSW 6 108828848 missense possibly damaging 0.91
R0367:Edem1 UTSW 6 108846752 missense probably damaging 1.00
R1165:Edem1 UTSW 6 108851253 missense probably damaging 1.00
R1354:Edem1 UTSW 6 108854316 missense possibly damaging 0.93
R1385:Edem1 UTSW 6 108846684 missense probably damaging 1.00
R1588:Edem1 UTSW 6 108841679 missense probably damaging 1.00
R1964:Edem1 UTSW 6 108844947 missense probably benign 0.03
R2060:Edem1 UTSW 6 108854287 missense probably damaging 0.99
R2106:Edem1 UTSW 6 108848725 missense probably damaging 0.98
R2393:Edem1 UTSW 6 108852543 missense probably damaging 1.00
R2443:Edem1 UTSW 6 108851269 missense probably benign 0.13
R3732:Edem1 UTSW 6 108841621 missense probably damaging 1.00
R3732:Edem1 UTSW 6 108841621 missense probably damaging 1.00
R3733:Edem1 UTSW 6 108841621 missense probably damaging 1.00
R3734:Edem1 UTSW 6 108841621 missense probably damaging 1.00
R4754:Edem1 UTSW 6 108841697 missense probably damaging 1.00
R4791:Edem1 UTSW 6 108841634 missense probably damaging 1.00
R4792:Edem1 UTSW 6 108828746 unclassified probably benign
R5326:Edem1 UTSW 6 108854329 missense possibly damaging 0.92
R5334:Edem1 UTSW 6 108848832 critical splice donor site probably null
R5501:Edem1 UTSW 6 108843100 critical splice donor site probably null
R5542:Edem1 UTSW 6 108854329 missense possibly damaging 0.92
R5976:Edem1 UTSW 6 108842962 missense probably damaging 0.99
R6177:Edem1 UTSW 6 108851198 splice site probably null
R6556:Edem1 UTSW 6 108854357 missense probably benign 0.00
R6835:Edem1 UTSW 6 108854399 missense probably benign 0.00
R7192:Edem1 UTSW 6 108829004 missense probably benign 0.00
R7239:Edem1 UTSW 6 108854380 missense probably benign
R7442:Edem1 UTSW 6 108851305 nonsense probably null
R7780:Edem1 UTSW 6 108841628 missense probably benign 0.00
R7902:Edem1 UTSW 6 108854377 missense possibly damaging 0.88
R8103:Edem1 UTSW 6 108852563 missense probably damaging 1.00
R8359:Edem1 UTSW 6 108846813 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- GCTTCAAAATAATGCCCGCG -3'
(R):5'- AAGACCCTGGTGTGTTCTCAG -3'

Sequencing Primer
(F):5'- ATGCAATGGCGAGCGCTTG -3'
(R):5'- TGTGTTCTCAGGGACCCG -3'
Posted On2020-06-30