Incidental Mutation 'R8135:Vmn1r74'
ID632219
Institutional Source Beutler Lab
Gene Symbol Vmn1r74
Ensembl Gene ENSMUSG00000047655
Gene Namevomeronasal 1 receptor 74
SynonymsV1rg5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R8135 (G1)
Quality Score205.009
Status Not validated
Chromosome7
Chromosomal Location11833980-11853276 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 11847603 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 277 (C277S)
Ref Sequence ENSEMBL: ENSMUSP00000055148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050416] [ENSMUST00000228471]
Predicted Effect probably benign
Transcript: ENSMUST00000050416
AA Change: C277S

PolyPhen 2 Score 0.356 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000055148
Gene: ENSMUSG00000047655
AA Change: C277S

DomainStartEndE-ValueType
Pfam:7tm_1 22 290 1.3e-7 PFAM
Pfam:V1R 34 296 1.2e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000228471
AA Change: C277S

PolyPhen 2 Score 0.356 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.7%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl3 A G 1: 78,696,995 I420V probably benign Het
Adam7 A T 14: 68,516,573 M359K probably damaging Het
Adra1d C T 2: 131,561,772 A133T probably damaging Het
B3galnt2 T A 13: 13,970,869 probably null Het
Camk1g A G 1: 193,354,027 V175A possibly damaging Het
Cfi A G 3: 129,855,000 N178D probably benign Het
Csf2rb T A 15: 78,348,119 I542K possibly damaging Het
Ctsz T C 2: 174,429,153 T183A probably benign Het
Dhx8 A G 11: 101,738,264 D213G unknown Het
Dph7 T C 2: 24,969,544 I271T probably benign Het
Edem1 G T 6: 108,829,061 E108* probably null Het
Enpp4 T C 17: 44,101,335 T328A probably benign Het
Fasl A G 1: 161,787,128 V122A probably benign Het
Fut2 T C 7: 45,651,142 T69A probably damaging Het
Gaa T C 11: 119,278,384 probably null Het
Galnt5 T A 2: 58,014,868 V481D probably damaging Het
Gsdma2 A G 11: 98,652,046 I211V probably benign Het
H2-M10.4 T C 17: 36,461,770 T107A probably benign Het
Iqcg T A 16: 33,029,024 K297N probably benign Het
Map2 A G 1: 66,413,669 T573A probably damaging Het
Nhsl1 A G 10: 18,531,432 D1438G probably damaging Het
Nipal2 A T 15: 34,678,573 Y41N possibly damaging Het
Obscn A T 11: 59,031,877 S5878T possibly damaging Het
Pde6a T C 18: 61,285,925 F791L probably damaging Het
Phip A T 9: 82,930,374 N308K probably benign Het
Pigc A G 1: 161,970,565 K39E possibly damaging Het
Robo2 T G 16: 73,933,160 I1050L probably benign Het
Rps2 A G 17: 24,720,435 K54E probably benign Het
Set T A 2: 30,069,427 D137E probably benign Het
Sipa1l1 A G 12: 82,341,301 I100M probably benign Het
Spdye4b T C 5: 143,195,022 V81A probably damaging Het
Tbc1d2 T C 4: 46,609,071 D722G probably benign Het
Tecpr1 T A 5: 144,198,602 D1011V probably damaging Het
Unc80 A T 1: 66,509,287 I573F possibly damaging Het
Vwa1 T A 4: 155,772,894 D149V probably damaging Het
Zfp397 T A 18: 23,956,507 V23E probably damaging Het
Zmynd8 T C 2: 165,812,426 D722G probably damaging Het
Other mutations in Vmn1r74
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01608:Vmn1r74 APN 7 11847633 missense probably damaging 0.98
IGL01673:Vmn1r74 APN 7 11847390 missense possibly damaging 0.94
IGL03023:Vmn1r74 APN 7 11847330 missense possibly damaging 0.46
IGL03409:Vmn1r74 APN 7 11847313 missense probably damaging 0.99
R0393:Vmn1r74 UTSW 7 11847315 missense possibly damaging 0.79
R1488:Vmn1r74 UTSW 7 11847583 missense probably benign 0.02
R1707:Vmn1r74 UTSW 7 11847577 missense probably damaging 0.98
R1998:Vmn1r74 UTSW 7 11847375 missense probably damaging 1.00
R1999:Vmn1r74 UTSW 7 11847375 missense probably damaging 1.00
R2139:Vmn1r74 UTSW 7 11847316 missense probably damaging 1.00
R4027:Vmn1r74 UTSW 7 11846971 missense probably damaging 0.98
R4576:Vmn1r74 UTSW 7 11846769 splice site probably null
R4619:Vmn1r74 UTSW 7 11847471 missense possibly damaging 0.61
R4619:Vmn1r74 UTSW 7 11847476 missense probably damaging 1.00
R5371:Vmn1r74 UTSW 7 11847057 missense probably damaging 1.00
R5606:Vmn1r74 UTSW 7 11846895 missense probably benign 0.01
R6464:Vmn1r74 UTSW 7 11847204 missense possibly damaging 0.87
R6901:Vmn1r74 UTSW 7 11847441 missense probably benign 0.00
R6920:Vmn1r74 UTSW 7 11847648 missense probably benign 0.01
R7223:Vmn1r74 UTSW 7 11846967 nonsense probably null
R7231:Vmn1r74 UTSW 7 11846961 missense probably benign 0.34
R7418:Vmn1r74 UTSW 7 11847154 missense possibly damaging 0.88
RF049:Vmn1r74 UTSW 7 11847140 frame shift probably null
RF063:Vmn1r74 UTSW 7 11847140 frame shift probably null
Z1176:Vmn1r74 UTSW 7 11847009 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTCCATGGTGAGTATTCTCTACAGAC -3'
(R):5'- ATGTCATAGCATTGCACAACAG -3'

Sequencing Primer
(F):5'- TGGTGAGTATTCTCTACAGACATAAG -3'
(R):5'- TGTCATAGCATTGCACAACAGATAAC -3'
Posted On2020-06-30