Incidental Mutation 'R0011:Trim58'
ID63222
Institutional Source Beutler Lab
Gene Symbol Trim58
Ensembl Gene ENSMUSG00000037124
Gene Nametripartite motif-containing 58
SynonymsLOC386443, LOC216781
MMRRC Submission 038306-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R0011 (G1)
Quality Score146
Status Validated
Chromosome11
Chromosomal Location58640465-58652404 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 58643120 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 167 (T167S)
Ref Sequence ENSEMBL: ENSMUSP00000074594 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075084]
Predicted Effect probably benign
Transcript: ENSMUST00000075084
AA Change: T167S

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000074594
Gene: ENSMUSG00000037124
AA Change: T167S

DomainStartEndE-ValueType
RING 15 58 2.95e-7 SMART
BBOX 90 131 2.93e-11 SMART
coiled coil region 192 241 N/A INTRINSIC
PRY 289 341 5.33e-23 SMART
SPRY 342 461 6.16e-29 SMART
Meta Mutation Damage Score 0.0772 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik T A 7: 131,229,993 L389Q probably damaging Het
A930011G23Rik T C 5: 99,232,354 Y344C probably damaging Het
Alox15 A G 11: 70,349,596 V253A possibly damaging Het
Ank3 A G 10: 69,979,451 probably benign Het
Art3 T A 5: 92,403,612 Y17N probably damaging Het
Asic3 C T 5: 24,417,492 probably benign Het
Bach2 G T 4: 32,244,655 probably benign Het
Brip1 C A 11: 86,186,998 K201N possibly damaging Het
Casc1 T A 6: 145,179,055 M515L probably damaging Het
Ccdc88a T C 11: 29,374,364 F6S probably damaging Het
Celsr2 A G 3: 108,413,402 I698T probably benign Het
Cenpf A G 1: 189,650,706 S2664P probably benign Het
Cfap54 A T 10: 93,065,225 C156S probably damaging Het
Cops4 C A 5: 100,527,981 Q28K probably benign Het
Cyb5a T A 18: 84,877,822 probably benign Het
Diaph3 A T 14: 86,866,408 C847S probably damaging Het
Dnah3 T C 7: 120,019,701 K1648R probably damaging Het
Emilin2 C T 17: 71,273,868 G621E probably benign Het
Enpp1 T A 10: 24,670,002 K228* probably null Het
Epg5 T C 18: 77,948,483 C132R probably benign Het
Epha7 G A 4: 28,962,564 D961N probably benign Het
G6pc2 C A 2: 69,226,565 probably benign Het
Gm7361 C T 5: 26,258,878 probably benign Het
Grin2c T C 11: 115,255,750 Y476C probably damaging Het
Hnrnpul1 T G 7: 25,742,915 probably benign Het
Igf2bp1 T C 11: 96,005,584 D17G probably damaging Het
Insrr T C 3: 87,809,616 C688R possibly damaging Het
Itgb2l T C 16: 96,427,661 probably benign Het
Kidins220 T A 12: 24,999,352 V322E probably damaging Het
Klk1 C T 7: 44,229,535 T149I probably benign Het
Mbd3l1 A G 9: 18,484,567 probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mrc1 T C 2: 14,261,337 probably null Het
Mtr T C 13: 12,238,052 probably benign Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Npy4r C T 14: 34,146,723 V203M probably damaging Het
Olfr965 T A 9: 39,719,627 N133K probably benign Het
Pik3r4 C A 9: 105,644,637 T134K probably benign Het
Rdh19 T A 10: 127,856,911 L149Q probably damaging Het
Sema3e C T 5: 14,144,011 R85* probably null Het
Shtn1 A G 19: 59,032,218 S191P possibly damaging Het
Slc39a11 A T 11: 113,247,833 F279L probably benign Het
Slc4a1 T C 11: 102,357,110 K353E possibly damaging Het
Slc6a18 A T 13: 73,665,619 M515K possibly damaging Het
Snapc4 A G 2: 26,364,813 I1225T probably benign Het
Spidr A T 16: 15,966,603 W534R probably benign Het
Tmem202 T A 9: 59,524,801 N81I probably benign Het
Tnfrsf1b T G 4: 145,222,966 R297S possibly damaging Het
Trim55 A G 3: 19,670,999 T227A probably benign Het
Trp53i11 A T 2: 93,199,353 probably benign Het
Ttn T C 2: 76,810,355 H5356R probably damaging Het
Tyrp1 C T 4: 80,840,793 T301I probably damaging Het
Wdr17 A T 8: 54,672,501 I448K possibly damaging Het
Wscd1 T C 11: 71,788,828 V509A probably damaging Het
Zfp251 A G 15: 76,854,554 V108A probably benign Het
Other mutations in Trim58
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02351:Trim58 APN 11 58651350 missense probably damaging 1.00
IGL02358:Trim58 APN 11 58651350 missense probably damaging 1.00
IGL02792:Trim58 APN 11 58640466 utr 5 prime probably benign
IGL02794:Trim58 APN 11 58640466 utr 5 prime probably benign
IGL02875:Trim58 APN 11 58640466 utr 5 prime probably benign
IGL02934:Trim58 APN 11 58640466 utr 5 prime probably benign
IGL03083:Trim58 APN 11 58651390 missense probably benign 0.01
IGL03213:Trim58 APN 11 58651167 missense probably benign 0.00
R0011:Trim58 UTSW 11 58643120 missense probably benign 0.02
R0735:Trim58 UTSW 11 58651393 missense probably benign 0.16
R1294:Trim58 UTSW 11 58643127 missense probably benign 0.28
R1929:Trim58 UTSW 11 58640667 missense possibly damaging 0.84
R2104:Trim58 UTSW 11 58643138 splice site probably benign
R2311:Trim58 UTSW 11 58643108 missense probably benign 0.02
R2981:Trim58 UTSW 11 58651561 missense probably damaging 1.00
R3432:Trim58 UTSW 11 58646961 splice site probably benign
R4270:Trim58 UTSW 11 58651267 missense probably damaging 1.00
R4450:Trim58 UTSW 11 58651365 missense probably benign 0.03
R4841:Trim58 UTSW 11 58651324 missense probably damaging 0.96
R4842:Trim58 UTSW 11 58651324 missense probably damaging 0.96
R5262:Trim58 UTSW 11 58651668 missense possibly damaging 0.88
R5979:Trim58 UTSW 11 58646083 missense probably damaging 1.00
R6101:Trim58 UTSW 11 58651615 missense probably benign 0.01
R6684:Trim58 UTSW 11 58651620 missense probably benign 0.00
R6747:Trim58 UTSW 11 58651264 missense probably benign 0.02
R7126:Trim58 UTSW 11 58640579 missense probably damaging 1.00
X0026:Trim58 UTSW 11 58645969 missense probably damaging 1.00
X0067:Trim58 UTSW 11 58647105 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TCTGCTGACTTTCGTGAGTCCAAC -3'
(R):5'- TCCACCAGTGAGTCTGACCGTAAG -3'

Sequencing Primer
(F):5'- TTCGTGAGTCCAACAGTCAG -3'
(R):5'- CTGACCGTAAGATTCGGATAGCA -3'
Posted On2013-07-30