Incidental Mutation 'R8135:Gsdma2'
ID632224
Institutional Source Beutler Lab
Gene Symbol Gsdma2
Ensembl Gene ENSMUSG00000017211
Gene Namegasdermin A2
Synonyms2210411P14Rik, 2210006M16Rik, 2200001G21Rik, 2210009F20Rik, Gsdm2, Gsdml2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R8135 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location98646759-98657964 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98652046 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 211 (I211V)
Ref Sequence ENSEMBL: ENSMUSP00000091470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017355] [ENSMUST00000093938]
Predicted Effect probably benign
Transcript: ENSMUST00000017355
AA Change: I44V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000017355
Gene: ENSMUSG00000017211
AA Change: I44V

DomainStartEndE-ValueType
Pfam:Gasdermin 6 251 2.9e-73 PFAM
low complexity region 259 273 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093938
AA Change: I211V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000091470
Gene: ENSMUSG00000017211
AA Change: I211V

DomainStartEndE-ValueType
Pfam:Gasdermin 3 418 9.5e-144 PFAM
low complexity region 426 440 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.7%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl3 A G 1: 78,696,995 I420V probably benign Het
Adam7 A T 14: 68,516,573 M359K probably damaging Het
Adra1d C T 2: 131,561,772 A133T probably damaging Het
B3galnt2 T A 13: 13,970,869 probably null Het
Camk1g A G 1: 193,354,027 V175A possibly damaging Het
Cfi A G 3: 129,855,000 N178D probably benign Het
Csf2rb T A 15: 78,348,119 I542K possibly damaging Het
Ctsz T C 2: 174,429,153 T183A probably benign Het
Dhx8 A G 11: 101,738,264 D213G unknown Het
Dph7 T C 2: 24,969,544 I271T probably benign Het
Edem1 G T 6: 108,829,061 E108* probably null Het
Enpp4 T C 17: 44,101,335 T328A probably benign Het
Fasl A G 1: 161,787,128 V122A probably benign Het
Fut2 T C 7: 45,651,142 T69A probably damaging Het
Gaa T C 11: 119,278,384 probably null Het
Galnt5 T A 2: 58,014,868 V481D probably damaging Het
H2-M10.4 T C 17: 36,461,770 T107A probably benign Het
Iqcg T A 16: 33,029,024 K297N probably benign Het
Map2 A G 1: 66,413,669 T573A probably damaging Het
Nhsl1 A G 10: 18,531,432 D1438G probably damaging Het
Nipal2 A T 15: 34,678,573 Y41N possibly damaging Het
Obscn A T 11: 59,031,877 S5878T possibly damaging Het
Pde6a T C 18: 61,285,925 F791L probably damaging Het
Phip A T 9: 82,930,374 N308K probably benign Het
Pigc A G 1: 161,970,565 K39E possibly damaging Het
Robo2 T G 16: 73,933,160 I1050L probably benign Het
Rps2 A G 17: 24,720,435 K54E probably benign Het
Set T A 2: 30,069,427 D137E probably benign Het
Sipa1l1 A G 12: 82,341,301 I100M probably benign Het
Spdye4b T C 5: 143,195,022 V81A probably damaging Het
Tbc1d2 T C 4: 46,609,071 D722G probably benign Het
Tecpr1 T A 5: 144,198,602 D1011V probably damaging Het
Unc80 A T 1: 66,509,287 I573F possibly damaging Het
Vmn1r74 T A 7: 11,847,603 C277S probably benign Het
Vwa1 T A 4: 155,772,894 D149V probably damaging Het
Zfp397 T A 18: 23,956,507 V23E probably damaging Het
Zmynd8 T C 2: 165,812,426 D722G probably damaging Het
Other mutations in Gsdma2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02002:Gsdma2 APN 11 98650974 missense probably damaging 1.00
IGL03091:Gsdma2 APN 11 98652002 missense probably damaging 1.00
IGL03252:Gsdma2 APN 11 98649090 missense probably damaging 1.00
IGL03279:Gsdma2 APN 11 98657723 missense unknown
R0116:Gsdma2 UTSW 11 98649183 missense probably damaging 1.00
R0443:Gsdma2 UTSW 11 98657688 missense probably damaging 1.00
R0521:Gsdma2 UTSW 11 98654901 nonsense probably null
R0626:Gsdma2 UTSW 11 98651984 missense probably damaging 0.96
R1163:Gsdma2 UTSW 11 98650858 missense probably damaging 0.96
R1340:Gsdma2 UTSW 11 98657649 missense probably damaging 0.97
R1834:Gsdma2 UTSW 11 98649079 missense probably damaging 1.00
R1972:Gsdma2 UTSW 11 98650918 missense probably benign 0.04
R2344:Gsdma2 UTSW 11 98655591 missense probably damaging 1.00
R2964:Gsdma2 UTSW 11 98657259 missense probably damaging 1.00
R4093:Gsdma2 UTSW 11 98650851 missense probably benign 0.42
R4256:Gsdma2 UTSW 11 98651932 splice site probably null
R4711:Gsdma2 UTSW 11 98649613 missense probably damaging 0.96
R5175:Gsdma2 UTSW 11 98652612 missense probably benign 0.01
R6734:Gsdma2 UTSW 11 98649590 missense possibly damaging 0.94
R6909:Gsdma2 UTSW 11 98652557 nonsense probably null
R7621:Gsdma2 UTSW 11 98649549 missense probably benign
R7749:Gsdma2 UTSW 11 98657721 missense unknown
Predicted Primers PCR Primer
(F):5'- GGGCCATAAGTTCAGAACACAG -3'
(R):5'- TGGTTCTGTCTCCAGCAATG -3'

Sequencing Primer
(F):5'- TACTGGACATCCTACTGAAGGC -3'
(R):5'- TGGGCAATATAAGATGCTGCTCCC -3'
Posted On2020-06-30